TABLE 2.

Primers used in this study

Primer type and nameNucleotide sequence
Deletion primers
    rbmB_del_AGATCTCTAGAGTGAGCGAGTGGAACAGTCA
    rbmB_del_BGAACGCATTTCTCGTTTCTTTCGAACATGTCA
    rbmB_del_CAAGAAACGAGAAATGCGTTCGAATCATCCTC
    rbmB_del_DGATCCCATGGGACCGACAGCAAGTGCAATA
    rbmC_del_AGATCTCTAGAAGCTGGGCTAAACAGAACAAG
    rbmC_del_BTAATCGCCACCAGGCGGCTGATAATACACC
    rbmC_del_CCAGCCGCCTGGTGGCGATTAAATTCACGATG
    rbmC_del_DGATCCCATGGGGCAGTTTAATGGCGATCAT
    rbmD_del_AGATCTCTAGAGAAGGATGGCTCTAGCGTGT
    rbmD_del_BCAATGAAATTGGCAGTTTAATGGCGATCAT
    rbmD_del_CTTAAACTGCCAATTTCATTGAGCGACCATGC
    rbmD_del_DGATCGAGCTCGGACCCAACCGAGATTATCA
    rbmEF_del_AGATCTCTAGACAACTTTGCATCCAAGACCA
    rbmEF_del_BTTCATTTGATCCGGGCTTAACCAATACCTT
    rbmEF_del_CTTAAGCCCGGATCAAATGAAGCGGTAGTGTTT
    rbmEF_del_DGATCGAGCTCGAAACCAATTGAAAACAACCAA
    bap1_del_ACTATGAGCTCGCTACCTCCCGTCTGTTTCA
    bap1_del_BGCGGAACGCGCTGTTTCATGGCTTGACCTTC
    bap1_del_CCATGAAACAGCGCGTTCCGCTGAAGTAAAGA
    bap1_del_DCTAGTCTAGAAGCTTCGGCTTTAACCCAAT
Complementation primers
    rbmB_com FGATCCCCGGGGTGAGCGAGTGGAACAGTCA
    rbmB_com RGATCCTCGAGGACCGACAGCAAGTGCAATA
    rbmC_com FGATCCCCGGGCTAGAAAATGCTTCTTGAAA
    rbmC_com RGATCCTCGAGTTGCTCTTCATCTCCTG
    rbmD_com FGATCCCCGGGCGACTCATCGCTTTACT
    rbmD_com RGATCCTCGAGCCCAGATAACTGACTTG
    rbmEF_com FGATCAAGCTTCAACTTTGCATCCAAGACCA
    rbmEF_com RGATCCTCGAGGAAACCAATTGAAAACAACCAA
    bap1_com FGATCCCCGGGGACTCGATCGTGAGTTT
    bap1_com RGATCAAGCTTGGTTTATTCCTTTATCTTTTTA
Myc-tagging primers
    rbmB_myc FGATCCTCGAGGGTGCTGTTATACTTAAATC
    rbmB_myc RGATCGAATTCCATCTTTAATAAAGTGCTGTATA
    rbmC_myc FGATCCTCGAGAATGACGTCTCACTATATTG
    rbmC_myc RGATCGAATTCCGTAGACAAACTGGAAGC
    bap1_myc FGATCGAATTCATGAAACAGACAAAAACGTT
    bap1_myc RGATCTCTAGACGCTTCAGCGGAACGC