TABLE 1.

Oligonucleotides used in this study

NameSequence (5′ to 3′)aSitebStrandPositionc
hyuA-PETGCCACCGGCATCAATACC745828-745846
fadA-PECCGCCACTACAACCACTTC740565-740583
nifS-PEGTCAATCCTAGTTGTAGCG228368-228386
fadA-5ATGAATGAAGTGGTTGTAGTGGCG+740559-740582
fadA-3AAGCGGGTTTGAGCTTTGCAAGGG741235-741258
katA-5GTGGTGCATGCTAAAGGAAGC926909-926929
katA-3CAATGGATAATCTTGGAGATACC+926216-926238
16S-5GCTAAGAGATCAGCCTATGTCC1208855-1208876
16S-3TGGCAATCAGCGTCAGGTAATG+1208356-1208377
BShyuA-5ATGATATTTATATGATATTTTTGGG+745602-745626
BShyuA-3TTGCGTCTTTCATTTAGACTCC745792-745813
BSkatA-5ATCCGTCAATGCATTGAGATAG927348-927327
BSkatA-3CTTCGTAATATGACACTAAGCC+927114-927135
Pcag-5ataaagggatccCATTTTTAGCAAATTTTTGTTAATTGTGGBamHI+579674-79702
Pcag-3ttgaaatctagaGTTAGTGTCAAAGACTGCTAAAAATCXbaI579853-579878
PhyuA-5ctaatactgcagCCTTAACATCTTCATTCAAGGCPstI+745367-745388
PhyuA-3atactaggatccTAGCTAAACTCTCATCTTCTGGBamHI745912-745933
PfadA-5ctaatactgcagTATTGACAGCTATTGCCAAAGCPstI+740082-740103
PfadA-3atactaggatccCACATCGCTAGGCTTAAGGCBamHI740683-740702
PnifS-5atattcgaattcTCATTACCGCTCTTTATAACCEcoRI228011-228031
PnifS-3tttgatctgcagGTCAATCCTAGTTGTAGCGPstI228368-228386
1021com-1ttgcacgaattcTTAAAGGCCCATAGCGATGGEcoRI+1083718-1083737
1021com-2cttactggatccGGATTTTCTGTTATTTGCGCGBamHI1085018-1085038
1021com-3caatgtctgcagGGCGTTTGATCATAAATTGCPstI+1085058-1085079
1021com-4caatcagagctcTTGTAATGATCGCACAGCTGGSacI1085502-1085522
GST1021-5caagaaggatccTGAAAATCTTAATCATTGAAGACGBamHI+1084133-1084156
GST1021-3aaggatgaattcTTATTTGCGCGGTAAGTTATATTTCEcoRI1085004-1085028
  • a Sequences in uppercase letters are derived from the genomic sequence of H. pylori 26695 (35). Sequences introduced for cloning purposes are given in lowercase letters, and restriction recognition sequences are underlined.

  • b Restriction recognition site.

  • c Nucleotide positions refer to the genome sequence of H. pylori 26695 (35).