TABLE 1.

Primers used for PCR amplification of msp1β genes

PrimeraPrimer sequence (5′-3′)Product amplifiedProduct size (bp)
Msp1b1 TFCTTGACCAGAGCATTGACGCAC msp1β1 transcript1,875
Msp1b1/pg3 TRAGAAGACTGCTGTTGTTGCTGCProbe
Msp1b2 TFGTAACGAGCTTGCACAAATATGTGGG msp1 β2 transcript695
Msp1b2 TRGGAAGAAGACTGCTGTTGTGCAG
Msp1bpg3 TFGTCTATTGGCGATGCATTTGGCG msp1βpg3 transcript979
Msp1b1/pg3 TRAGAAGACTGCTGTTGTTGCTGC
Msp1bpg2 TFCCCACCTTGTGTGCATGGC msp1βpg2 transcript1,182
Msp1bpg2 TRCGCCAAAGTACACCAAAGGCC
Msp1bpg1 TFCAGAATTAGAGTATATCGCCCTGTATGCATG msp1βpg1 transcript536
Msp1bpg1 TRCCCAGTACGGGGGTTTCCC
Msp1b1/b2 OFCGGTTATCAAGACATTGTTAAGTAGGTAGGTG msp1β1 ORF2,530
Msp1b1 ORGCCGAATATGCGCAGATGGC
Msp1b1/b2 OFCGGTTATCAAGACATTGTTAAGTAGGTAGGTG msp1 β2 ORF2,338
Msp1b2 ORCTACCACGTTCTTGTATCCACACAAGG
Msp1bpg3 OFGCATAGGGAAGATTGAAGTACCAGC msp1βpg3 ORF2,096
Msp1bpg3 ORCTACACCGTGTCAGTTAAAGGTAGGG
Msp1bpg2 OFCACAGCAGCATATTCAGGAATGTTGAAG msp1βpg2 ORF1,466
Msp1bpg2 ORGCGATTTTCGCCTCACAGAGC
Msp1bpg1 OFCATCATCTCGCAGATGAGCACTCG msp1βpg1 ORF827
Msp1bpg1 ORGCGATACAACAGCCACAAAGCG
Msp1b1/b2 EFATGACAGAAGACGACAAGCAACAACProbe
  • a TF and TR indicate forward and reverse primers designed to amplify specific msp1 β transcripts. OF and OR indicate forward and reverse primers designed for the amplification of each msp1 β open reading frame (ORF). EF indicates a forward primer designed for expression of MSP161 and MSP162.