TABLE 2.

Oligonucleotides used for gene cloning and P. aeruginosa mutation engineering

Target geneOligonucleotide (5′→3′)a
Cloned
    flpFlp11 Up (GAGGCAGGGCTCTGTCTCGGTGAT)
Flp12 Down (AAGCTTCTGAACGGCAGGCTTTGTAG)
    fppAFppA Up-1 (TTAATACTAGTCGTCATTCGCTCCG)
FppA Down-1 (GTATTAGCCATAAGCATATAGTCG)
    fppA mutagenesisFppA Up-2 (CAGGAAGATCGCTGTGAATTCGATG)
FppA Down-2 (GTGCATTGGAATGCAGCCATACCGAAT)
    fppA(D17A)FppAD17A-Up (GCGGATATCAGGCCATCAAACGTT)
FppAD17A-Down (ACGTTTGATGGCCTGATATCCG)
    fppA(D78A)FppAD78A-Up (GGCGCTGCCGCGGTCAAGTACCT)
FppAD78A-Down (AGGTACTTGACCGCGGCAGCGCC)
Deleted
    flpFlp1 (CGCACCGAGCAGCAGCAGGC)
Flp2 (CTCGCGTCACATTCTTGTTTGTTTGCTC)
Flp3 (ACAAGAATGTGACGCGAGCGCTTTCCCGGT)
Flp4 (TGCGGCTGAAGACGGGCTGT)
    tadATadA1 (GAGTCACCACCGCCGAACTCTATC)
TadA2 (CGCCGTTCACATAGCAGCGCCGCCTTGGCC)
TadA3 (GCTGCTATGTGAACGGCGCGCAACTGCTGG)
TadA4 (GGGTGAAGATGTCGCGCAGCGGCT)
    rcpARcpA1 (CGTCCTGCCCGGCGACTATGTCGA)
RcpA2 (CGCCTCCTACATATGCCGGCTCCCCTCAAGG)
RcpA3 (CGGCATATGTAGGAGGCGCGCATGAACCAGAACT)
RcpA4 (TGCTCCTGCAACGCCTTGGCCAG)
    fppAFppA1 (CTCAGCACGGGGATGATCGC)
FppA2 (GTTTGCTCACATCCTGTTCTTCAGCCTTTTTT)
FppA3 (AACAAGATGTGAGCAAACTTGCGGAAAAC)
FppA4 (GCCATGCAGCAGTTCCTGCG)
  • a The mutagenic codons in FppAD17A-Up and FppAD78A-Up are indicated in bold.