TABLE 1.

Bacterial strains and primers used in this study

Strain or primerDescriptionSource or reference
S. pneumoniae
    TIGR421
    TIGR4STIGR4 but streptomycin resistant by selection of mutants22
    CP1296R6 derivative, cbp3::kan-rpsL+20
    TIGR4ΔspxBTIGR4S but spxB::kan-rpsL+ by transformation with ligation product of PCR fragments amplified with primer pairs TTM211-TTM212 in TIGR4, DAM406-DAM351 in CP1296, and TTM213-TTM214 in TIGR4, and prior to ligation digested with BamHI, BamHI and ApaI, and ApaI, respectivelyThis study
    Pn-20Serotype 35B, nasopharyngeal human isolateThis study
    Pn-20ΔspxBPn-20s but spxB::kan-rpsL+ by transformation with TTM211-TTM214 PCR product of TIGR4ΔspxBThis study
    Pn-20ΔlytAPn-20s but lytA::kan-rpsL+ by transformation with LAD4-LAD1 PCR product of Rx1ΔlytAThis study
    Rx118
    R610
    Rx1SRx1 but streptomycin resistant by selection of mutants
    Rx1ΔlytARx1S but lytA::kan-rpsL+ by transformation with ligation product of PCR fragments amplified with primer pairs LAD4-LAD3 in R6, DAM406-DAM351 in CP1296, and LAD2-LAD1 in R6 and prior to ligation digested with BamHI, BamHI and ApaI, and ApaI, respectivelyThis study
S. gordonii strain GP25113
Group A streptococcus strain 771Kindly supplied by Michael Wessels
Group C streptococcusThis study
S. aureus
    Strain NewmanNCTC 8178
    Strain ALRNasal isolate from a Wistar ratKindly supplied by Jean Lee
S. sciuriNasal isolate from an ICR mouseKindly supplied by Jean Lee
S. epidermidis strain RP62aATCC 35984
S. xylosusNasal isolate from a C57BL/6 mouseThis study
Primers
    DAM406TCTATGCCTATTCCAGAGGAAATGGAT22
    DAM351CTAGGGCCCCTTTCCTTATGCTTTTGGAC20
    TTM211CGTTAAGCGAGCGAGTGA corresponds to positions 1002-985 upstream of spxB in TIGR4This study
    TTM212TTTGGATCCGATGCAGTAATTTTCCCTTGAGTC positions 10-34 correspond to positions 26-3 within spxB in TIGR4This study
    TTM213AAAGGGCCCTCTCGCCGAAAATCAAATA positions 8-28 correspond to positions 3-23 downstream of spxB in TIGR4This study
    TTM214CGCCACGTCCAGAACATCC corresponds to positions 1199-1181 downstream of spxB in TIGR4This study
    LAD1CAAGGTATCCATCATTCC corresponds to 1011-993 downstream of lytA in R6This study
    LAD2CGCGGATCCACAGTAGAGCCAGATGGC positions 9-27 correspond to positions 921-939 within lytA in R6This study
    LAD3TTGGGCCCGTTGCACGCCGACTTGAGG positions 10-27 correspond to positions 37-54 within lytA in R6This study
    LAD4CTTTGCTTCTCAGAATCTAGG corresponds to 850-830 upstream of lytA in R6This study