TABLE 1.

Oligonucleotide primers used in this study

OligonucleotideSequence (5′-3′)Usea
1729CAGTTCGGCAATGAAGTCCG groEL probe
3260CACACTGGGACTGAGACATG16S rRNA probe
3261CGGCAGTCTCATTAGAGTGC16S rRNA probe
11076GACACCCAAATCGTCGGC rpoH probe
11077CGGCTATGACGGCTACGGG rpoH probe
14107GGACAGCGTATAACCCTTCTTC grpE probe
14108ATGAGCGAACAGACACAGCAG grpE probe
14109CTTGCAGTACGTGGATGGTTAC dnaK probe
14110CAAGACGTGATGGCTCTACAAC dnaK probe
14115GTGAGGACGTTCAAGTCGGTAT dnaJ probe
14116TGACACCCTTACCCTTCACG dnaJ probe
14308ATGCCTCGGATGTTGTTCAC groEL probe
15837CAGCAAACCGCGGATCCGCAGTTTCAmplification of rpoH gene
16764GCTGCCGTCCATTTTCATGqRT-PCR of recA
16766TGGCGCAAATCGAAAAAAGTqRT-PCR of recA
17456GACGGATAGGATCCTGTACAGCACAmplification of rpoH gene
23047GTCGGCAAGCCAGTCGATqRT-PCR of rpoH
23048CCGAAAAAGCCAAAATCGAAqRT-PCR of dnaK
23049ACCGGAAGCTATGGACAAAATCqRT-PCR of clpB
23050TGGTAATGTACGGCAGGTTGATqRT-PCR of dnaK
23052TCGCCTTCCTGCCATTCAqRT-PCR of marR
23053ACCGTTTCAGGCGTATGCAqRT-PCR of marR
23054CGCCATCATGGCAGACAACqRT-PCR of rpoH
23055TTTCAACGTGCGCCTTTTCqRT-PCR of clpB
23273CACGCGCCGCAAATCTqRT-PCR of secB
23274GGTGGAAACGCGCATATCCqRT-PCR of secB
  • a qRT-PCR, quantitative real-time RT-PCR.