TABLE 1.

Strains, plasmids, and primers used in this work

Strain, plasmid, or primerGenotype or sequenceSource or reference
M. tuberculosis strains
    H37RvWTATCC 25618
    MHD2 pafA::ΦMycoMarT7 (282) 6
    MHD18WT, pMV-306 6
    MHD62 pafA::ΦMycoMarT7, pMV306This work
    MHD63 pafA::ΦMycoMarT7, pMV-pafA This work
    MHD64 pafA::ΦMycoMarT7, pMV-pafABC This work
    MHD75 pafB::ΦMycoMarT7 (769)This work
    MHD76 pafC::ΦMycoMarT7 (466)This work
    MHD77 pafC::ΦMycoMarT7 (767)This work
    MHD79WT, pMN-FLAG-fabD-His6 24
    MHD78WT, pMN-FLAG-panB-His6 24
    MHD82 pafA::ΦMycoMarT7, pMN-FLAG-panB-His6 24
    MHD83 pafA::ΦMycoMarT7, pMN-FLAG-fabD-His6 24
    MHD98WT, pMV-pafC This work
    MHD99 pafC::ΦMycoMarT7 (466), pMV-pafC This work
    MHD100 pafC::ΦMycoMarT7 (767), pMV-pafC This work
    MHD102 pafC::ΦMycoMarT7 (466), pMN-FLAG-panB-His6 This work
    MHD112 pafC::ΦMycoMarT7 (466), pMN-FLAG-fabD-His6 This work
    MHD117 pafB::ΦMycoMarT7, pMN-FLAG-fabD-His6 This work
    MHD118 pafB::ΦMycoMarT7, pMN-FLAG-panB-His6 This work
E. coli strains
    DH5αF φ80dlacZΔM15 Δ(lacZYA-argF)U169 deoR recA1 endA1 hsdR17 (rK mK +) phoA supE44 λ thi-1 gyrA96 relA1 Gibco, BRL
    BTH101F cya-99 araD139 galE15 galK16 rpsL1 (Strr) hsdR2 mcrA1 mcrB1 16
    ER2566F λ fhuA2 [lon] ompT lacZ::T7 geneI gal sulA11 Δ(mcrC-mrr)114::IS10 R(mcr-73::miniTn10)2 R(zgb-210::Tn10)1 (Tets) endA1 [dcm] 3
Plasmids
    pMV306Hygr; integrates in single copy on the chromosome 31
    pMV-pafA Hygr; for complementation of the pafA mutantThis work
    pMV-pafABC Hygr; for complementation of the pafA mutantThis work
    pMV-pafC Hygr; for complementation of the pafC mutantsThis work
    pET24b(+)Kanr; for gene overexpressionNovagen
    pET24b+pafA Kanr; for overexpression of pafA This work
    pET24b+pafB Kanr; for overexpression of pafB This work
    pET24b+pafC Kanr; for overexpression of pafC This work
    pET24b+pafABC Kanr; for overexpression of pafABC This work
    pUT18CpafC Ampr; pafC cloned into pUT18C with XbaI and KpnI, translationally fused to the C terminus of the T18 domainThis work
    pUT18CpafB Ampr; pafB cloned into pUT18C with XbaI and KpnI, translationally fused to the C terminus of the T18 domainThis work
    pKT25pafC Kanr; pafC cloned into pKT25 with XbaI and KpnI, translationally fused to the C terminus of the T25 domainThis work
    pKT25pafB Kanr; pafB cloned into pKT25 with XbaI and KpnI, translationally fused to the C terminus of the T25 domainThis work
    pMN-FLAG-fabD-His6 Hygr; pMN402 with green fluorescent protein replaced by FLAG-fabD-His6 24
    pMN-FLAG-panB-His6 Hygr; pMN402 with green fluorescent protein replaced by FLAG-panB-His6 24
    pMN-FLAG-dlaT-His6 Hygr; pMN402 with green fluorescent protein replaced by FLAG-dlaT-His6 24
    pKD13Kanr; used for Southern analysis 8
Primers
    Rv2098c-f1GCCTGTTCCAGGTAGGTAGT
    Rv2097c-rtGTCATGGGTGACCAGCTGC
    Rv2098c-r1GCCGGACGGGCCGGGGAC
    tatA-f1GTGGGCAGTCTGAGTCCGTGGC
    tatA-rtGCCGGCCGAGCCTCGGTGC
    Rv2095-f1GGTCGCGTGAGGCCGAAGG
    tatC-rev1ATGCGAATACCAGACGAACC
    pafoperon-f1GTCACCACCGACGAAGAAAT
    pafoperon-r1ATCCACAGCTGGTTGAGGTC
    pafB-end-BTHGCGGTACCTCATGCCAGTGCTCCGGCTT
    pafB-start-BTHGCTCTAGAGATGGCGACCTCGAAAGTCGAAC
    pafC-start-BTHGCTCTAGAGATGAGCGCCCTGTCCACCCG
    pafC-end-BTHGCGGTACCTCACGGCGGCGCAGCTGC
    pafC-rev4-HindIIICGAAGCTTTCACGGCGGCGCAGCTGC
    pafC-rev4-HindIII-NO STOPCGAAGCTTCGGCGGCGCAGCTGCCTGGTA
    NdeI-pafAGGAATTCCATATGCAGCGTCGAATCATGGGC
    pafB-for1-NdeIGGAATTCCATATGGCGACCTCGAAAGTCGAACG
    pafB-rev1-HindIIIGTCAAGCTTTGCCAGTGCTCCGGCTTGCGC
    pafC-for1-NdeIGGAATTCCATATGAGCGCCCTGTCCACCCGG
    pafA-rev1-HindIIIGTCAAGCTTCATGCTCGCGATCAGCCGCTTAAC
    pafA-RT-forGATCAGCCCCCACAGACC
    pafA-RT-revGCTTAACCCGCTCATCGAC
    pafB-RT-forGTGTGGACCTACGCAGCAT
    pafB-RT-revTCGAATCTCAAGCTCGATCA
    pafC-RT-forGCTGTTCGACGGTGACCTAT
    pafC-RT-revATCCAATCCTCAGAGGCGTA