TABLE 1.

Primers used in gene prevalence studies

PrimerGeneSequence (5′ to 3′)Tannealing (°C)Amplicon size (bp)Reference
COLB FcbiACAAGACAGCACCAGTTATGGGTATT63430This study
COLB RGTTGTTGGTTTTGTTGGCGTAGTTAT
COLM FcmaCAGCGCCATTACCCCATAAATAGTGA63498This study
COLM RGGTTCGTTCGCCGGTGTAAGCGTTAG
CVAC FcvaCCACACACAAACGGGAGCTGTT6367923
CVAC RCTTCCCGCAGCATAGTTCCAT