TABLE 1.

Strains, plasmids, and primers used in this study

Strain, plasmid, or primerGenotype or sequenceSource or reference
Strains
    E. coli
        SM10λpirthi thr leu tonA lacY supE recA::RP4-2-Tc::Mu λpirR6K Kmr20
        PW744SM10λpir (pWM91ΔPTS)This study
        PW814SM10λpir (pWM91ΔEIIAGlc)This study
        PW862SM10λpir (pWM91ΔEI)This study
        PW863SM10λpir (pWM91ΔHPr)This study
        PW831SM10λpir (pWM91ΔEIIBCGlc)This study
        PW398SM10λpir (pWM91ΔvpsA)12
    V. cholerae
        PW357MO10 lacZ::vpsLplacZ; Smr8
        PW751MO10 ΔPTS; SmrThis study
        PW836MO10 ΔEIIAGlc; SmrThis study
        PW864MO10 ΔEI; SmrThis study
        PW867MO10 ΔHPr; SmrThis study
        PW844MO10 ΔEIIBCGlc; SmrThis study
        PW396MO10 ΔvpsA; Smr12
        PW877MO10 ΔPTS ΔvpsA; SmrThis study
Plasmids
    pWM91oriR6K mobRP4 lacI ptac tnp mini-Tn10Km; Kmr Apr18
    pWM91ΔptspWM91 carrying a fragment of PTS operon harboring an internal, unmarked deletionThis study
    pWM91ΔEIIAGlcpWM91 carrying a fragment of VC0964 harboring an internal, unmarked deletionThis study
    pWM91ΔEIpWM91 carrying a fragment of VC0965 harboring an internal, unmarked deletionThis study
    pWM91ΔHPrpWM91 carrying a fragment of VC0966 harboring an internal, unmarked deletionThis study
    pWM91ΔEIIBCGlcpWM91 carrying a fragment of VC2013 harboring an internal, unmarked deletionThis study
    pBAD-TOPO-EIIAGlcpBAD-TOPO carrying a fragment of VC0964This study
    pBAD-TOPO-EIpBAD-TOPO carrying a fragment of VC0965This study
    pBAD-TOPO-HPrpBAD-TOPO carrying a fragment of VC0966This study
    pBAD-TOPO-EI(H189A)pBAD-TOPO carrying a fragment of VC0965 with mutation at position 189 (H to A)This study
Primers
    Construction of V. cholerae PTS deletion
        P342CGAACGTTTTAAATCGAACCA
        P343TAACGAGCGGCCGCACCTGCTGGTAACAAAATGGT
        P344TGCGGCCGCTCGTTATTTTGCTTCTTTAACAAACTGTGC
        P345CCCAGTCAGGGGCTTTTT
    Construction of V. cholerae EI deletion
        P439CACTGATTGGCCTTCTTCTG
        P440TAACGAGCGGCCGCAGCAGAAATTGAAGCTTGCGT
        P441TGCGGCCGCTCGTTATGGAGATGCTAGAATGCCTG
        P442CAGAAAACGGCCTTCACACT
    Construction of V. cholerae HPr deletion
        P443CAGTGGCTTGCTCTTCGATA
        P444TAACGAGCGGCCGCAGCTCTGATGGACCAACTTCA
        P445TGCGGCCGCTCGTTAGATTTCTACTTGCTTCTCGT
        P446CTGTGTTACCAAGTTCAGG
    Construction of V. cholerae EIIAGlc deletion
        P447CACGGTGCTTTCCCATTAAC
        P448TAACGAGCGGCCGCACCGATCCTACGCGTGACCAAG
        P449TGCGGCCGCTCGTTAACCCATTGTGTCATGCTCCT
        P450CTCTCTCCAGCGGTTCTGAC
    Construction of V. cholerae EIIBCGlc deletion
        P451AGCTGTTTGGTGGAACTGGT
        P452TAACGAGCGGCCGCAGAGTGGATCCGTAACAACGG
        P453TGCGGCCGCTCGTTAGCTGGGACTAACGGCATACC
        P454CACCTTATCTCGCCCCAGTA
    Construction of V. cholerae EI complementation fragment
        P455CGCTTTCGCTGCGATGAATTTATCTACGC
        P456ATTTCAGGCATTCTAGCATCTCCAGG
    Construction of V. cholerae HPr complementation fragment
        P457TGAAGTTGGTCCATCAGAGC
        P458TACGAGAAGCAAGTAGAAATCAC
    Construction of V. cholerae EIIAGlc complementation fragment
        P459CTTGGTCACGCGTAGGATCGGTG
        P460GGTCTGTTTGACAAACTTAAGAAGC
    Construction of V. cholerae EI (H189A) complementation fragment
        P510CATGATAGAAGTGGCAGAGGTACGG
        P511CCGTACCTCTGCCACTTCTATCATG