TABLE 2.

Primers used in this study

PrimerPrimer sequenceaPositionsbGeneUsec
CPP535′ GCGTCGACGAGATATGGTCTTTTAGATGG 3′−333 to −312pilT promoterGUS
CPP555′ GCTGCAGCAGATGCTCCTTCTTTAACTG 3′+28 to + 48pilT promoterGUS
CPP2305′ GCGTCGACCTTGAAGATTTAGATAAGCCTC 3′+19 to + 41pilD promoterGUS
CPP2315′ GCTGCAGCCTTCCAATTATTAATCCAAATAA 3′−361 to −341pilD promoterGUS
CCP-F5′ AACTAGGATATAGACCTAAT 3′+172 to +192ccpAMP
CCP-R5′ TGATCCCATATCATACATTG 3′+876 to +896ccpAMP
KO-F5′ CTGGAGTGTCAATAGCAAC 3′+34 to +53ccpAPROBE
KO-R5′ TCTCCTAGTGATGAACTCAT 3′+366 to +386ccpAPROBE
CPP2655′ ATATCCATCAAGTTCATCTATAGAG 3′−505 to −481ccpACOMP
CPP2665′ TATGTTACCTAATGATTATGCATT 3′+1012 to +1036ccpACOMP
P15′ ATGCTGATTACTCAGAAGCT 3′−774 to −754ccpA upstreamPCR
P25′ CTCATAAGCCCTTGATGAAC 3′+1461 to +1484ccpA downstreamPCR
M13-F5′ GTA AAA CGA CGG CCA GT 3′pUC18 vectorPCR
M13-R5′ CAGGAAACAGCTATGAC 3′pUC18 vectorPCR
  • a Restriction sites that have been added are underlined.

  • b The nucleotide position numbering begins from the first codon and refers to the relevant position within the respective gene sequence (36).

  • c GUS, construction of plasmid for β-glucuronidase assay; MP, construction of mutator plasmid; PROBE, construction of DNA probe for southern blot analysis; COMP, construction of complementing plasmid.