TABLE 1.

Primers used in this study

PrimeraSequence (5′→3′)
Tn5-I-end FTTCGTCGACGGACTGCGGCC
PhlA P1TCAGGTGCTCAATAAAAAGTCTATCGACAAGGAGTCGGCGTGTAGGCTGGAGCTGCTTCG
PhlB P2TATGGGCGTTTACGGCTGCGCGTAGTGCGTGCCCAAGCGGCATATGAATATCCTCCTTAG
FliC-FATGGCACAAGTAATC
FliC-RCGTTCAGTGCGCCTTC
FliA-FGTGAGCGATCTGTATAC
FliA-RGCAGCTCGTCGAGCATC
FlhD-FATGGGGAATATGGGTAC
FlhD-RCTTTGGTCAGGCGTTC
PhlA-RCCTCCTGCGATTGCTGCC
PhlA-FATGAGTATGCCTTTAAG
16S-FAAACTGGAGGAAGGTGGGGATGAC
16S-RATGGTGTGACGGGCGGTGTG
  • a F, forward primer; R, reverse primer.