TABLE 2.

Primers used in this study

GroupNo.Primer sequence (5′→3′)aLocationb (accession no.)
JanusJ.1CCGTTTGATTTTTAATGGATAATG7-30 (AY334019)
J.2GGGCCCCTTTCCTTATGCTT247511-247527 (AE005672)
nanAA.1TATCGAGTAGGGTAGTTCTT149-169 (X72967)
A.2ACGGGGCAGGTTAGTGACAT1953-1972 (J01754)
A.3TAGTTCAACAAAGGAAAATTGGATAA1101-1126 (J01754)
A.4ATTCTGCAGTTCTAGCACTAATAGACTCTT1008-1037 (U43526)
nanBB.1CATATGCAGTTTGGCTCTTAGTT4708-4730 (U43526)
B.2CATTATCCATTAAAAATCAAACGGTTTTCCTTCTTTCGTCTACTTCAC15076-5099 (U43526)
B.3ACCTATGTGATGATTTGGCAATTTTCCTTCTTTCGTCTACTTCAC25076-5099 (U43526)
B.4GGAAAGGGGCCCAGGTGTTGCCAAATCATCACATAGGT37076-7096 (U43526)
B.5TCATCGCTAGAAACCAACTCATC7363-7385 (U43526)
B.6TTGCCAAATCATCACATAGGT7076-7096 (U43526)
B.7GGAATTAACTCAGTATCCAACA4370-7391 (U43526)
B.8TTACACGCATCTACCATCTC7510-7529 (U43526)
nanCC.1GCAAACACTATTCCAATCATCACC1234554-1234577 (AE005672)
C.2TAGTGGTGTTTTTGGGGCTG1261423-1261442 (AE005672)
C.3GACAACAGCTGAACGTGGACATAA1239066-1239089 (AE005672)
C.4TAGTCCCATATTCGTTCTCAAGTC9376-9399 (AE008490)
C.5GTGTGGTAAGTATTGTGGTGAACG1259130-1259130 (AE005672)
C.6CAATCGTTATTCCTTTATCTGGAG8344-8367 (AE008491)
bgaAG.1AACTAGGTTGTCATACCATG149-168 (AE007374)
G.2GTAACTACTAATCCTGCACT6888-6907 (AE007374)
strHS.1CAGGAGGTTTTGCAATGAAAC719-739 (L36923)
S.2GTGTGGACATGAGTCCTG4613-4630 (L36923)
  • a Underlining indicates the reverse complement sequence of primers J.1 (1), B.6 (2), and J.2 (3).

  • b Locations are given as nucleotide positions in the indicated accession numbers.