TABLE 1.

Real-time PCR primers

Gene identification no.Gene nameOrientationaSequence
SMU.37purHFCCTGCTGACTACGCTGAGATTC
RTTGCTGCCAGACGCTTACG
SMU.1672clpPFAGCGGTGCCAAAGGAAAACG
RGCCATATCAGACTGCTGTGTGC
SMU.80hrcAFTGGAATTTGCTGGGCTTAACAC
RCATCTTCAGGTAGGCTTTGACG
SMU.81grpEFAGAGCGACAAAGTTTGCAGAGG
RCAACAGCAAGAGCACGTTCAAG
SMU.105scrRFTCGCATGGCATCCTTGAATCAG
RTCAGCAGCTAATTGACCTCCAC
SMU.128adhBFCAGGCTCAGGTATCGGCTCAG
RGGCGCAACCACCTTGATTCC
SMU.179HPbFATGATTGTGGGCTGTTCG
RCGTGTTCAGAGTGACCTAG
SMU.182sloAFF:CAATGGTGCGGGCAAGTC
RCGCATTCCTTGACTTTAATGGG
SMU.233ilvCFTTCTGCGCGTGTAGGTCTCC
RAACCACCCATAAGAACCGCTTG
SMU.255oppAFAAATTCGTGCCGTTCAAACAGC
RTCGCCGCCCCAAAGAGAC
SMU.872fruIFGGGACTTGGGAAGTACGAGAAG
RAAACAAGAGCTGCTGCACCG
SMU.1745HPFGGCGCGTTGTTTATTTAACCC
RCATCCATTGCTTCTGTGATTCG
SMU.1924gcrRFTGGACGGGTATGAAGTGATTCG
RCATCTGCTCCACGATCAAGACC
SMU.2020rl16FAGGCTGCTCGTATCGCTATGAC
RACGTACACCGATGGCCTTAGC
SMU.1517covRFACACGATTACAGCCTTTGATGG
RCTTCCTTAGCCACTTCAAGACC
SMU.78fruAFGGGACTTGGGAAGTACGAGAAG
RAAACAAGAGCTGCTGCACCG
SMU.2057cadDFTCCATTCAAGACAGACCACAAGC
RTTCCTAATTCACGCCCAACAGC
SMU.602HPFGCAACAGCAGCAGGAGTC
RGGGAACAACAACAATTCGTAAAG
SMU.426copAFAGTGTCCTTAGCAACAACAGC
RGAACCTTAATCTCCTCGCCATC
SMU.2005adkFACCTTAAGCTAGATGGCGTTATC
RGAGCAATGTTGACATCTAAGCG
SMU.942mvaAFTGAGTGTTGACACCAAAGAGG
RGACTGAGGAAACGAAGATTAACC
SMU.1591ccpAFATTTATGATGTTGCCCGTGAAGC
RGATAACCACACCTACCGTAGTCG
SMU.1288rplSFCCGTACAGACATTCCTAACTTCC
RACACCAACACCGCTTGAAATC
SMU.562clpEFTTGTTGGTGCTGGTTCTGC
RGGGCTGAATACCTTTAAGAATCG
SMU.256oppBFATCTGGTTGGGGCTCTTTTGC
RTGCGATAGGCGTGATGATTGG
SMU.382HPFCCGCTGAGTATTATGGACATGG
RTGAGAGAGGAAATGGAAGTAGGG
SMU.646gphFGGCTCTTGCGGTCACTTATAGG
RCATCACGCTTAACTTGCTCTTGG
SMU.1916comDFTATGGTCTGCTGCCTGTTGC
RTGCTACTGCCCATTACAATTCC
SMU.2042dexTFF-TTAAGGCTGGGATCATGAATCG
RAACAGGTTCACCATCAAGAGC
SMU.1877manLFGCATCTGACACAGTTGCTAAGG
RCATTAGCTTTAACACCGCCAGG
SMU.765nox1FGGGTTGTGGAATGGCACTTTGG
RCAATGGCTGTCACTGGCGATTC
  • a F, forward primer (5′-3′); R, reverse primer (3′-5′).

  • b HP, hypothetical protein gene.