TABLE 1.

Oligonucleotides used for construction of plasmids containing sensor kinase gene fragments

PrimerSequence (5′ to 3′)aPurpose
SMU45-FCTATATAATGCAAGCAAATCAGTTGAGpIB12 construction for smu45 inactivation
SMU45-RCCGTTTCTTAATTTCATGAAATCCGACpIB12 construction for smu45 inactivation
SMU486-FTTCTGCTTAATCAGGCCATCACACAGGpIB14 construction for smu486 inactivation
SMU486-RCCTCAATATTACTCTTATCAGTTAATTCTCpIB14 construction for smu486 inactivation
SMU577-FCATTCCTATGATGTTGCTTAACAGTCTAGGpIB15 construction for smu577 inactivation
SMU577-RCTGCAAGGCCTTGATTTCTGCAATATTAGpIB15 construction for smu577 inactivation
SMU660-FCATTATTCAGTTGCCTGGATGAATAAGTATCpIB16 construction for smu660 inactivation
SMU660-RGAATCTTTATATCTTTCGTTGCAGCAAGpIB16 construction for smu660 inactivation
SMU928-FGTCTTATATGAGAAATATTAATCTCCATGpIB17 construction for smu928 inactivation
SMU928-RCTTCTGCTTTGACATAAATATCAGAAGCpIB17 construction for smu928 inactivation
SMU1009-FGAACCAAGGAATTTAACTATGTTAACTGCACpIB18 construction for smu1009 inactivation
SMU1009-RCCTTAATCTTAATGGTGATCTGCCCACpIB18 construction for smu1009 inactivation
SMU1037-FGACAAGCCTTATAGCTCTTCAGGpIB19 construction for smu1037 inactivation
SMU1037-RTTCTTCAAGATTAACTGTGCTTGpIB19 construction for smu1037 inactivation
SMU1128-FGATATTGTTGAACAAGAAGCTAAGAATATTTACpIB20 construction for smu1128 inactivation
SMU1128-RGAATTTCTGTTATTTCTGGTTTGATACCATCpIB20 construction for smu1128 inactivation
SMU1145-FGTCCAATCTTATCGTTTACCTCAACAGCpIB21 construction for smu1145 inactivation
SMU1145-RCTCCGTTTGCTTTCCATGACCATATTGpIB21 construction for smu1145 inactivation
SMU1516-FGATAGTTATACTTACAATGATTTGATTACpIB22 construction for smu1516 inactivation
SMU1516-RGTATCAATTTCAATCCAAACTGATTTGTCpIB22 construction for smu1516 inactivation
SMU1548-FGATTAATGGCATTATTTATGGGATTGpIB23 construction for smu1548 inactivation
SMU1548-RGATAGACTGATATCAGATAAACCAAAGAGpIB23 construction for smu1548 inactivation
SMU1814-FCCAAAAGACAGTATTATCCGATATAGCpIB24 construction for smu1814 inactivation
SMU1814-RCTCTAAGTTACCATTTGTCAATCGAGCpIB24 construction for smu1814 inactivation
SMU1916-FGCAATCATATTCTTTATCTTGGATGGAACpIB25 construction for smu1916 inactivation
SMU1916-RGATATTATAACGGGTATCCTGCAATTGpIB25 construction for smu1916 inactivation
SMU1965-FTTGTCTTAATGATTCTTACCTTTATTTCpIB13 construction for smu1965 inactivation
SMU1965-RCATCTTGAATACCTTCTCTAACAACATCTGpIB13 construction for smu1965 inactivation
Bam-SMU486-F1cgcggatccTGTTGATGTCTCAGTTAGTTTGGpIB55 construction for smu486 complementation
Bam-SMU487-R2cgcggatccAACTCTGTTGGTTTTGAAACAACAGCpIB55 construction for smu486 complementation
Bam-SMU1127-R2ggcggatccGGAGGTAATAAAGACATTGGCpIB302 construction for smu1128 complementation
Bam-SMU1129-F2ggcggatccGGAAGATACTCCACCTAATGGCpIB302 construction for smu1128 complementation
Eco-SMU1516-R2ggcgaatTCCTTTCTTTTATCCTTAGACCTTTCpIB303 construction for smu1516 complementation
Bam-SMU1516-F2ggcggatccATTGATTTTGATATAATCGTAGAGGGpIB303 construction for smu1516 complementation
  • a Sequences homologous to the S. mutans genome sequence are in uppercase. Synthetic restriction sites added for cloning purposes are underlined.