TABLE 2.

Primers used to generate PCR products for use in excision experiments

PrimerSequence (5′-3′)Purpose
Tn5382intCCTAGAAGTCGACGGTTAGCCAATGCGGGAATGAACTn5382 integrase end and downstream flanking region
Tn5382int flankCCTAGTCGGATCCGTTCATTGATGGTCGGTGC    PCR product
Tn5382 bp1CCTAGAAGTCGACGGTATTAGCAGTATGGTTCAGCTn5382 upstream flanking region and bp 1 region PCR
Tn5382bp1 flankCCTAGTCAAGCTTGTGGCGTTATCGTCACAGTC    product
Tn916intCCTAGAAGTCGACGTCTTGTTGCTTAGTAGTACTn916 integrase end and downstream flanking region
Tn916int flankCCTAGTCGGATCCTATGGGAGATGATACTGTGGTCAC    PCR product
Tn916 bp1CCTAGAAGTCGACTTCACTTTTCAAGGATAAATCGTn916 upstream flanking region and bp 1 region PCR
Tn916 bp1 flankCCTAGTCAAGCTTGTTGGATGTCAATTGATAGTACTAG    product
Tn5386intCCTAGAAGTCGACGCTCACGGCTCATTTGGTTCTGCTn5386 integrase end and downstream flanking region
Tn5386int flankCCTAGTCGGATCCTGTACCGACGATTACTACTTTACGAC    PCR product
Tn5386 bp1CCTAGAAGTCGACTGATGTGCTGTATTCATAACTn5386 upstream flanking region and bp 1 region PCR
Tn5386 bp1 flankCCTAGTCAAGCTTTTAGGTGCGATTGCTGTC    product
Upstream intTn5386CCAAGTCTAGCCATGGAATATTTATATGACGTATCTAGGCTTGCPrimer for amplifying the Tn5386 int gene; used with StopintTn5386
Stop intTn5386CCAAGTCTATGGATCCGTATTTACTACAACGCACATATCCPrimer for amplifying the Tn5386 int gene; used with UpstreamintTn5386
Upstream intTn916CCAAGTCTAGCCATGGTTATAGATACATTGGACGCAATCTAGPrimer for amplifying the Tn916 int gene; used with StopintTn916
Stop intTn916CCAAGTCTATGGATCCATTTGTACTACTAAGCAACAAGACGCTCCTGPrimer for amplifying the Tn916 int gene; used with UpstreamintTn916
Tn5386Xis upCAAGTCTAGCCATGGTTCTGCCCACAAGAATGGPrimer for amplifying the Tn5386 xis and int genes; used with StopintTn5386
Tn916Xis upCCAAGTCTAGCCATGGTGGAACTCCCGTGAGCTTTGPrimer for amplifying the Tn916 xis and int genes; used with StopintTn916
Tn5382-1TACCGACATTCAAGAACTTCTAAAAAGATAATCUsed to detect circularization of Tn5382 construct
Tn5382-2TTGGTAGTAAATTGAGTTCTCATATCCTGCUsed to detect circularization of Tn5382 construct
Tn916-1GTTTTGACCTTGATAAAGTGTGATAAGTCCUsed to detect circularization of Tn916 construct
Tn916-17890CACTTCTGACAGCTAAGACATGAGUsed to detect circularization of Tn916 construct
Tn5386-1TGAACCCTTATAAAAGCGAATACAGCTAGGUsed to detect circularization of Tn5386 construct
Tn5386-2GCTAAACTGACATTTAAGAAGTTATGAAGAGATAAGTGGUsed to detect circularization of Tn5386 construct
pACYC Cm-1GATTGGCTGAGACGAAAAACATATTCTCUsed for quantitative PCR to equalize plasmid quantities in plasmid preparations for excision amplifications
pACYC Cm-2TATGGGATAGTGTTCACCCTTGTTACACUsed for quantitative PCR to equalize plasmid quantities in plasmid preparations for excision amplifications