TABLE 1.

PCR primers used in this study

PrimeraSequenceb
Primers used to generate promoter-gusA gene fusions
    Atu6178(virG)-FGTCAAGCTTACCGCTGAGCACCTGCTACAG
    Atu6178-RTGACTCGAGATCGACGACCACGACATCGAC
    Atu1131(aopB)-FGTCAAGCTTGCGAGATCGGAGGCGATTGCCC
    Atu1131-RTGACTCGAGTTGACCGTACCACCGAGGTAGGC
    Atu2160-FGTCAAGCTTGGTATTCAAGGTGGCGCAGGCTG
    Atu2160-RTGACTCGAGACCACGGTCGTAGCGCGGACGATA
    Atu4343(impA)-FGTCAAGCTTCCAGCAGCCAATGCGGTATATCCA
    Atu4343-RTGACTCGAGCTTCTGCGCGTGCCTGGTTTCTTTC
Primers used to knock out genes
    Atu0290-FTCACTGCAGTCAGGCGAATGCGGCAAATGGTTG
    Atu0290-RCAGTCTAGACAATCGGCCTTGACGATCTCGTAG
    Atu0841-FTCACTGCAGGTTCCACACCCATCTCCTGCGAA
    Atu0841-RCAGTCTAGAAGAAGCGTCAGCGTGCCGCCATTG
    Atu0944(cscA)-FCAGTCTAGAACCGGCATCACCGTCGTCCATAC
    Atu0944-RTCACTGCAGTGGATCTGCTGCTCGGGAATACGG
    Atu2055-FCAGTCTAGAGCGATCCAGTCGGTCGTGGTCATG
    Atu2055-RTCACTGCAGTGGTGACGTTGTCGCCGACATTGG
    Atu2224(aldA)-FCAGTCTAGACGGTCGCCTATCATTTCCATGAAC
    Atu2224-RTCACTGCAGGCAAAGAAGATGTTCGGCGACTTG
    Atu2470-FCAGTCTAGATCGCCGTCTTCCTCGTCATCATC
    Atu2470-RTCACTGCAGATGGAGAACCAGAGCTTGCGTTTG
    Atu3274-FCAGTCTAGAGCCGATGTTCAGGCCGCCATTTCG
    Atu3274-RTCACTGCAGCTGGGTATCGGCCTCGATGGTCAA
    Atu4130(acsA)-FCAGTCTAGACGATGGCACACGACGCGAGATAAG
    Atu4130-RTCACTGCAGCGACGAAATCCGCAAGCGTCAAAC
    Atu5278(katN)-FGACTCTAGAGATCCTGAAGGCGCTCCCAAAGAT
    Atu5278-RCATCTGCAGCTCTTCGCCCAGCGTCTGTTCGAAC
  • a The suffix F indicates a forward primer, and the suffix R indicates a reverse primer.

  • b The underlining indicates restriction enzyme sites.