TABLE 2.

Primers used in this study

NameRegionSequence (5′-3′)Product size (bp)Temp (°C)
Inverse
    InvVC1809FVPI-2ACGATTGGTGATCCGTTGAGC2,05360
    InvVC1758RAGAGTGGTACTTGCCAAAGC
    InvVC0185FVSP-IAGTAGCCCTTAAATCGTGAGTCC1,88957
    InvVC0175RGCGTCCATACTGGCAGATGCTCG
    InvVC0516FVSP-IIAGCGCCATATTCGCACTCTG1,92259
    InvVC0490RGACACTGAAAACCCCAATGCTCC
Nested
    NestVC1809FVPI-2TCACACCTCTCAGGTTGG1,30355
    NestVC1758RGCCGTAATGCAGCGATGG
    NestVC0185FVSP-ITCTCTTAAGGGCGCGAACAC67958
    NestVC0175RCGAAGGTGTGTCATCTCGACG
    NestVC0516FVSP-IIAGTCGATATCCTGCCAACGTGC1,49359
    NestVC0490RACACCAAGCGACTCCTGAGG
SOE constructs
    SOEVC1758aVPI-2GCTCTAGAGCACTTTTGCGTACGTCCAAGC38760
    SOEVC1758bGCCGTAATGCAGCGATGG
    SOEVC1758cVPI-2CCATCGCTGCATTACGGCGCCTAACGAAGCCTCTGGTG42260
    SOEVC1758dGCGAGCTCGCACCAGCTCATAAGCTTTCGACG
    SOEVC0185aVSP-IGCTCTAGAGCAGCTAAAGCATCACCAACAGG48056
    SOEVC0185bACAGTCTGGATTGCGCGTTGA
    SOEVC0185cVSP-ITCAACGCGCAATCCAGACTGTAAATCTCTCATGAGCTGCCCA38357
    SOEVC0185dGCGAGCTCGCCGAACAATTTTGACGTTCCCCGA
    SOEVC0516aVSP-IIGCTCTAGAGCCATGAGTTTTCTGCGTTGTTCG41057
    SOEVC0516bTCGAGAGTGCATCAGCACGT
    SOEVC0516cVSP-IIACGTGCTGTAGCACTCTCGAGGTTTGATGTCTTGAATGGGGAC38658
    SOEVC0516dGCGAGCTCGCACTCGCTCTGATGGTGATGGCCT
Flanking mutant genes
    fkVC1757FVPI-2AGAGTATGGCGGTCACCA2,09856
    fkVC1759RACTTCCAATAGCGCCAGC
    fkVC0184FVSP-IACTCAACTGCGGCAGAGCT1,69059
    fkVC0186RTGGTTGGTCTACACGGCATCG
    fkVC0515FVSP-IIAGAATGGAGTTCAGAGTGTCG2,28956
    fkVC0517RGATTCTGCGACCGCAACCAG
attB primers
    VPI2attFVPI-2AGAGTGAAAGTCGCCAAAGC52157
    VPI2attRGGGTGCAATTTCGCATGTTGC
    VSPIatt2FVSP-IGCATGATCAGGCGTGGAATCG83557
    VSPIatt2RAGGCTACATCAAGGTCGATGAG
    VSPIIattFVSP-IITGGTGGGTTAGAGTGCCGTC39759
    VSPIIattRCGTCATCCAAGCCGCTCAG