TABLE 1.

Sequences of primers used in this studya

PrimerSequence (5′→3′)Accession no.Primer location (bp)Reference or source
IS1999ACAGCAATTCTTTCTCCGTG AF133699 1205-1223 21
IS1999B1CAAGCACAACATCAAGCGC AF133699 2189-2171 21
IS1999B2INVTCGTTTTAGGTGAAGTTCTGG AF133699 3475-3495This work
IS1999IRLextTGCGCTTCCACCCTAATTTG AF133699 3292-3611This work
IS1999IRRextggatccccggaATTCGCCA AF133699 1190-1183This work
IS1999IRRext2TGGGATTGGAGGTACTCAGGC AF133699 1260-1240This work
IS-1KpnTTAAggTACCGCTAACTTTGTTTTAGGG AF133699 3695-3668This work
IS-2EcoctcTgaatTCATAAATCAGCCATAGCATAGC AF133699 1142-1164This work
IS-3EcoGTAgaATTCGCCAATCAGTTGCTC AF133699 1195-1172This work
IS-4PstTGTcTGcaGTTATGGAGCAGCAACGATG AF133699 1094-1121This work
IS-1EcoTTgAATTcCCGCTAACTTTGTTTTAGGG AF133699 3695-3668This work
IS-1SacTTAAATTACCGCggACTTTGTTTTAGGG AF133699 3695-3668This work
IS-4EcoTGaaTtcTGTTATGGAGCAGCAACGATG AF133699 1094-1121This work
IS-stopXmnTCACGAAAGGTTTCC TCatca TTGCATACGTTTGG AF133699 1461-1494This work
OXA-48ATTGGTGGCATCGATTATCGG AY236073 1280-1299 21
OXA-48BGAGCACTTCTTTTGTGATGGC AY236073 2023-2003 21
IS1999.2FATCCGCTTTTTTTACAGGCCGA AY648695 4374-4395This work
bla OXA-48GSP1AAAGCATGTAGCATCTTGCTCATAC AY236073 1674-1650This work
bla OXA-48GSP2ACAGGCACAACTGAATATTTCATC AY236073 1614-1591This work
bla OXA-48GSP3TCTGTCCATCCCACTTAAAGACTT AY236073 1544-1521This work
GapA1ATCAACGGTTTTGGCCGTAT X02662 502-521Corvec
GapA2GTTGATAACTTTAGCCAGCGG X02662 972-952Corvec
TnpA1999-GSP1GCTTAGCCAAAACCAACCAT AF133697 649-630This work
TnpA1999-GSP2TAGGGGATAGGACTTCTCAT AF133697 496-477This work
TnpA1999-GSP3ATGCGCTTGATGTTGTGCTT AF133697 289-269This work
  • a Nucleotides that were not complementary to the sequence submitted to the GenBank database under the accession number AF133699 are shown by lowercase letters; the restriction sites introduced into the primer sequences are boldfaced; the two successive TGA stop codons that are located in the IS-stopXmn primer (inverse sequence) are underlined.