TABLE 2

Primers used in this study

Primer function and nameSequence (5′–3′)
77bpIR mutant construction, verification, and complementation
    ErmFCCGATAGCTTCCGCTATTGC
    ErmRGAAGCTGTCAGTAGTATACC
    Ermchk1CGTAAATGTTCAACCAAAGCTGTG
    Ermchk2CTCAAGTCTCGATTCAGCAATTGC
    R2-77bpIRTGTAGATAAATTATTAGGTATACTACTGACAGCTTCTGGAATTATTACATTCTTTGTGCA
    F2-77bpIRACCGATGAGCAAAAAAGCAATAGCGGAAGCGATCGGATCATTCCACTGGGATTTAGGA
    F3-77bpIRGCTCCGCGATGCCCTCAAA
    R3-77bpIRCCC AAG CAA CCA ATA ACAGACACA
77bpIR complementation strain construction
    F3-77bpIRGCTCCGCGATGCCCTCAAA
    R1-77bpIRTAACATCCCCAGAAGCACCAGACT
    TetQ-FCGTTCCATTGGCCCTCAAAC
    TetQ-RCTCCTGCCATTCATAGAGGC
    Knock-in-R1GGAGCACAAGTGCTGTTGAC
pTloop1 plasmids
    Loop1Hind-ForwCAAGAAGCTTTCCATATGTCAGAGATTCAAATCATAGAG
    Loop1Eag-RevCAAGCGGCCGTTAATGGGACCTTTGCACAATAAGCA
    Loop2Ale-ForwCATTCACTGACGTGTGACAATCAAATCCTTTCAACG
    Loop2Eag-RevTGATCGGCCGTCTGCACTGGCAATGTAACC
5′/3′ RACE
    First-round PCR
        sORF + 140RevCGGATTTCCACAAGTGGAAAGATAG
        sORF + 170FwdACCAAATAGTCGCCTGACACA
    Second-round PCR
        sORF + 130RevGTGGAAAGATAGCTTTCCACCG
        sORF + 210FwdAAAGTGCCTGCTTATTGTGCAAAG
    Third-round PCR
        sORF + 28RevACATCCAACGACATGACCGT
        0106p1-RevGAGCGTAGCAATCGTTAGATC
qRT-PCR
    PG0108-ForwCATGTGTAGAGGCTGCAAC
    PG0108-RevGACGCTCTCGATAGATTAGATCAG
    PG0113-ForwCGTCCAGGAGATAGACTGATTGTTAC
    PG0113-RevTGGTGGATAATAAGGCATCATAATCA
    PG0118-ForwGCGATGAATTGACAGAACAGCAT
    PG0118-RevTTGCGTAATTTGGCTCATAATAACTG
    PG0121-F2TGTAGCTGAAAAGGCCAACC
    PG0121-R2GCACGCTCGCTCACTGAGAA
    PG1138-F1GCTGCGAAAAAGTTCTGTCC
    PG1138-R1GTATATCCCCCTCCCATTGC
    PG_1141-ForwGGCAGCAGATTATGCCATCA
    PG_1141-RevGAGGCAAATCAGTGGCTACAA
    16S-ForwTGTTACAATGGGAGGGACAAAGGG
    16S-RevTTACTAGCGAATCCAGCTTCACGG
asRNA RT-PCR
    asRNA-ForwGATTGGAGGAGCACAAGTGCTGTT
    asRNA-RevAGTGGAAAGATAGCTTTCCACCGG