TABLE 1.

Analysis of CRISPR repeat sequences

CRISPRTypeRepeat sequence (5′-3′)aNo. of sequenced repeatsFrequency (%)
CRISPR1Typical repeatGTTTTTGTACTCTCAAGATTTAAGTAACTGTACAAC2,82099.7
Repeat variantsGTTTTTGTACTCTCAAGATTTAAGTAACTGTGCAAC80.28
GTTTTTGTACTCTCAAGATTTAAGTAACCGTACAAC10.04
Terminal repeatGTTTTTGTACTCTCAAGATTTAAGTAACTGTACAGT 10787.0
GTTTTTGTACTCTCAAGATTTAAGTAGCTGTACAGT 108.1
GTTTTTGTATTCTCAAGATTTAAGTAACTGTACAGT 64.9
CRISPR2Typical repeatGATATAAACCTAATTACCTCGAGAGGGGACGGAAAC12974.6
Repeat variantGATATAAACCTAATTACCTCGAGAAGGGACGGAAAC4425.4
Terminal repeatGATATAAACCTAATTACCTCGAGAGGGGACTTTTTT 59100
CRISPR3Typical repeatGTTTTAGAGCTGTGTTGTTTCGAATGGTTCCAAAAC67099.8
Repeat variant TTTAACTCGCTGTGTTGTTTCGAATGGTTCCAAAAC10.15
Terminal repeatNot different from the typical repeat
  • a Mutations as compared to the typical CRISPR repeat sequence are indicated by underscoring.