TABLE 5.

List of new spacers found in CRISPR1 and the corresponding region in phages 2972, 858, and DT1

SpacerPhagea5′ positionbSpacer length (pb)Proto-spacer sequencec3′ flanking regiondStrand/moduleeORF/function in the genome of the phage used in the challenge
S18583137830CAACACATTCAACAGATTAATGAAGAATACAAAGAAAAAA(+)/EORF40/primase
S22972*2543230TCCACTCACGTACAAATAGTGAGCGTACTCCTAAAAGGAT(-)/LORF27/unknown
S32972*1720230TTACGTTTGAAAAGAATATCAAATCAATGACGAGAAAGAT(+)/LORF20/receptor-binding protein
S429723158230CTCAGTCGTTACTGGTGAACCAGTTTCAATTGAGAAAAAA(+)/EORF38/primase
S529722207530AGTTTCTTTGTCAGACTCTAACACAGCCGCTCAGAAAGTT(+)/LORF21/tail protein
S62972*3452130GCCCTTCTAATTGGATTACCTTCCGAGGTGTTAGAATTCC(-)/EORF44/unknown
S72972*1029930AAGCAAGTTGATATATTTCTCTTTCTTTATTAAGAAAACG(-)/LORF17/unknown
S829723001629CGTTTTCAGTCATTGGTGGTTTGTCAGCGAAAGAAATAA(-)/EORF37/replication
S92972*787430TTACTAGAGCGTGTCGTTAACCACTTTAAATCAGAATATG(+)/MORF11/unknown
S102972*2065030TTCGTTAAAGTCACCTCGTGCTAGCGTTGCATAGAAAGTT(-)/LORF20/receptor-binding protein
S112972*836030ATAACGGTAGCAAATATAAACCTGTTACTGTCAGAAGCTA(+)/MORF12/unknown
S122972a1899830GAAGTAGCCATACAAGAAGATGGATCAGCACCAGAAATTG(+)/LORF20/receptor-binding protein
S132972*3360230GATGTCACTGAGTGTCTAAGCATTGCGTACGAGGAAATCA(+)/EORF42/DNA binding
S142972*483030TGAATAAGCAGTTCTTGACGACCAACCGACATAGAAAAGT(-)/MORF6/capsid protein
S152972*3444429CAATTAACACAGCAATTAACACAGTATATACAGAAATTG(+)/EORF44/unknown
S162972*679930ATGCCATTCTTTAAAGAGGCTTTACTCGTTAAAGAAAACG(+)/MORF9/capsid protein
S1729723054730GTTGGCGGACTACTCCTTCGAGGGGTTGATCCAGAAATTA(+)/EORF37/replication
S1829723037029GAAGCACCTCTTGCGTTGATAAAAGTATTGCAGAAAATG(+)/EORF37/replication
S1929723170929ACATATCGACGTATCGTGATTATCCCATTCAAGAAAACA(+)/EORF38/primase
S202972*111330TTATATCGAAGAACGACTGAAAGAGCTTGAGAAGAAAAAA(+)/MORF2/small terminase
S212972*1918830AAATCAACGTACATCCCGATATAGGCACGATTAGAATCAG(-)/LORF20/receptor-binding protein
S2229723170830GACATATCGACGTATCGTGATTATCCCATTCAAGAAAACA(+)/EORF38/primase
S2329722652931TGAAGTATTAGGTCTCTCAAAAGATGATATTGTAGAATACT(+)/EORF31/Cro-like repressor
S2429722992330AGTTGATTGCGTAATCAACCATCTCCATAATTAGAATGGA(-)/EORF37/replication
S252972*44130GCAACACTCAAACGTTGCAAACGCAAGCTTCGAGAATATC(+)/EORF1/unknown
S2629723160631CTCAGTCGTTACTGGTGAACCAGTT*TCAATTGAGAAAAAA(+)/EORF38/primase
S272972*2703230TTTCATCGTCAATTTCCATGTTATAAATCTCTAGAAACTG(-)/EORF33/unknown
S2829722653030GAAGTATTAGGTCTCTCAAAAGATGATATTGTAGAATACT(+)/EORF31/cro-like repressor
S2929723213629ATTGGCATGATTTCAATTTTAATTGGGATGTAGAAAAAG(+)/EORF38/primase
S302972*3396830TCCAAGTTATTTGAGGAGTTATTAAGACATGAAGAAATAT(+)/EORF43/unknown
S3129723080330TACCGAAACGACTGGTTTGAAAAATTCAAGGAAGAAAATC(+)/EORF38/primase
S322972*3304430ATTGTCTATTACGACAACATGGAAGATGATGTAGAAATTT(+)/EORF41/unknown
S338583033530CTTCAAATGTACTGCAAGGCTGCAAAAGTACCAGAAAATA(+)/EORF38/unknown
S34DT11453530GCTACTGAAAGCTACGAGGTTGGTAATCCTAAAGAATGGG(+)/LORF17/tail protein
S35DT11325530GTAGTTAGAGCGCTTGAAGCTAACGGTATAGAACCAAACA(+)/LORF15/tail protein
S36DT12913230TTAGATCTCATGAGTGGCGACAGTGAGCTTGTAGAATTAC(+)/EORF36/primase
S37DT12083730AACGATGAGGAACTCTTGGCAAAACTTACACAAGAATAGC(+)/LORF22/unknown
S38DT1989330GCATTCATGGTTTGTTGGTATTTAACGTATTCGGAACTGG(-)/LORF15/tail protein
S39DT1260330TATTTTATCAGTCATCATGGCGTCATAGCCGAAGAAAACG(-)/MORF4/Large terminase
  • a *, DNA regions that are 100% identical between phages 858 and 2972.

  • b That is, the 5′ position of the proto-spacer in the phage genome.

  • c Underlined and italicized nucleotides indicate a mismatch between the phage and the spacer. An asterisk indicates a deletion.

  • d That is, the 3′ flanking sequence in the phage genome. A mismatch in the AGAAW motif is boldfaced.

  • e Transcription module: E, early expressed genes; M, middle expressed genes; L, late expressed genes.