TABLE 1.

Bacterial strains, plasmids, and oligonucleotide primers used

Strain, plasmid, or primerDescription or sequenceaSource or reference
Strains
    P. aeruginosa PAO1Wild type
    A. tumefaciens A136 (pCF218) (pMV26)HSL detection strain 2
    PAO-JP2 lasI-rhlI double mutant of PAO1 17
Plasmids
    pMS402Expression reporter plasmid carrying the promoterless luxCDABE gene; ori of pRO1614 (15) 6
    pKD201 lasI promoter cloned upstream of the luxCDABE in pMS402This study
    pKD202pMS402 containing rhlI promoterThis study
    pKD204pMS402 containing lasR promoterThis study
    pKD205pMS402 containing rhlR promoterThis study
    pKD207pMS402 containing aprA promoterThis study
    pKD-rhlA pMS402 containing rhlA promoter 6
Oligonucleotide primers
    lasI forwardTTTGGATCCTATTACTCTCTGA
    lasI reverseACGCAACTTGTGGATCCCGC
    rhlI forwardAGAGGATCCAGAAGAAGTTCG
    rhlI reverseCTTCCAGGGATCCAGAGAG
    lasR forwardCTGCTCGAGCCGGGCTCGGCCTGTTCT
    lasR reverseCGGGATCCGGATGGCGCTCCACTCCA
    rhlR forwardCATGCGCGAGCAGGAGTTGCb
    rhlR reverseTAGGGATCCTAATCGAAGCCCAGGCGC
    aprA forwardTCACTCGAGACCGCGAAGGACGTGC
    aprA reverseTTGGGATCCTGGGTATACGCATCGC
  • a Underlined nucleotide sequences indicate endonuclease restriction sites.

  • b The XhoI site 20 bp downstream of this primer was used to clone the promoter.