TABLE 1.

V. vulnificus strains, plasmids, and primers used in this study

Bacterial strain, plasmid, or primerDescription or sequence (5′-3′)Source or reference, or nt location (plasmid)a
Strains
    BT2
        CECT897ATCC 33147, isolated from diseased eels in Japan, 1979; serovar E; API20E code 4006005ATCC
        CECT4602Isolate from diseased eels in Spain, 1990; serovar E; API20E code 5206005CECT
        CECT4865Isolate from a diseased shrimp in Taiwan; serovar E; API20E code 5206005CECT
        CECT4866Clinical isolate from a patient in Australia; serovar E; API20E code 5306005CECT
        CECT4870Isolate from diseased eels in Sweden, 1991; serovar E; API20E code 5306005CECT
        CECT4917Isolate from diseased eels in Spain, 1997; serovar E; API20E code 4306005CECT
        CECT5198Isolate from diseased eels in Spain, 1999; serovar A; API20E code 5346105CECT
        CECT4999Isolate from diseased eels in Spain, 1990; serovar ECECT
        CT095CECT4999 with a Cmr cassette inserted between the two HincII sites in ORFvep07 of pR99This study
        CT188CECT4999 Δvep07This study
        CT218Plasmid-free derivative of CECT4999This study
        CT223CT218 transconjugant with pC4602-1This study
        CT225CT218 transconjugant with pC4602-1 and pC4602-2This study
        CT226CT218 transconjugant with rearranged plasmidsThis study
        CT227CT218 transconjugant with pC4602-2This study
        CT237Spontaneous Smr mutant of CT218This study
        CT239CT188(pCT166)This study
        CT244CT218(pCT166)This study
        CT295CT095 transconjugant with pC4602-1This study
    BT1
        YJ016Clinical isolate from a patient in Taiwan38
        SW058Plasmid-free clinical isolate from a patient in TaiwanLab collection
        LF044Spontaneous Smr mutant of a plasmid-free derivative of strainYJ016Lab collection
        CT162Spontaneous Smr mutant of SW058Lab collection
        CT167YJ016(pCT166)This study
Plasmids
    pJRD215Broad-host-range plasmid17
    pIT009Derivative of pJRD215 with the Smr gene between two XmnI sites replaced by the multiple-cloning-site-containing lacZ gene cloned from pUC19This study
    pCT166pIT009 inserted with ORFvep07 cloned from pR99 at the XbaI siteThis study
Primers
    K1GCAGGATCAAGTGATCGG56065-56082 (pC4602-1)
    99PGATGAGCTTGAGCGTTCAGG2556-2575 (pC4602-2)
    M2GCTGAAAACGGTGTGATGG3041-3059 (pC4602-1)
    179RGCAGTTTTATGCTTTAGCGGC59690-59710 (pC4602-2)
    VF10CATCACTCAACTTCTCGACTCC10241-10262 (pC4602-1)
    VR10AGCATCTCACCACGACGTC10609-10627 (pC4602-1)
    VF25GCCAAGTGCTAATCCATCC16716-16734 (pC4602-2)
    VR25TGCTCAAAGCCATACTCTCT16324-16342 (pC4602-2)
    VF51GGACAGATACAAGGGCAAATGG14985-15006 (pC4602-2)
    VR51AGAGATGGAAGAAACAGGCG15309-15328 (pC4602-2)
    AD1-RGCTGGTTAAGTGTTTCAATGG33788-33808 (pC4602-1)
    D1CAAGCTCAGCATGAATGTGG33088-33107 (pC4602-1)
    Maz6CAGTGGGATAAGTCTCAGC3012-3030 (pC4602-1)
    Maz7GGCTAAGTACATTCCCAAGC3314-3333 (pC4602-1)
    CT39-RATGCGCCTGACTAGATTGC53142-53160 (pC4602-1); 66038-66056 (pC4602-2)
    JB02R-4GAAACAGCCTAACGCACAG684-702 (pC4602-1); 684-702 (pC4602-2)
    JB02RCACCATCATCAACTTTCAACC2096-2116 (pC4602-1); 2096-2116 (pC4602-2)
    L1GAAGCTGACCGCAGCGTAAC52777-52796 (pC4602-1); 65673-65692 (pC4602-2)
    JB02FGATTCGCAAGGAAATAGAGAC47558-47578 (pC4602-1); 60454-60474 (pC4602-2)
    P1GGGCAACTAACTCATCGTGTG27987-28007 (pR99); 38203-38223 (pC4602-2)
    P2CTTGGTCAACACTGGATGTGCTGG33028-33051 (pR99); 43244-43267 (pC4602-2)
    P3CGGGAATGAACCAAGTGATGTC33175-33196 (pR99); 43391-43412 (pC4602-2)
    P4GTTGGCTTTACCGAACATCGCCG37968-37990 (pR99); 48184-48206 (pC4602-2)
    P5GAAACACGCAAAGCCGATGC40241-40260 (pR99); 50457-50476 (pC4602-2)
    P6ATCCGCTGCGTTCGAACCACA48324-48344 (pR99); 58540-58560 (pC4602-2)
    P7AATTCAACGGTGGCGAAGGGC48150-48170 (pR99); 58366-58386 (pC4602-2)
    C51FGCACGGACTTTTCCTTGC7107-7124 (pR99); 16227-16244 (pC4602-2)
    C51RGCAATGGTCATTCGTGGG4963-4980 (pR99); 14083-14100 (pC4602-2)
  • a ATCC, American Type Culture Collection, Manassas, VA; CECT, Spanish Type Culture Collection, Valencia, Spain.