TABLE 2.

Gene-specific primers used for real-time RT-PCR

Gene identification no.Gene nameForward primerReverse primer
SMa0233otsACAGTCTCTATGCCGATTGACCATTTGATCCCTCTCG
SMb20249ACGTGCTCGTCTCCTATCTTATTGAGCTGGTAGGTCCGAT
SMb20345GACGATGAGGACGATGATATGGCAAAGGGCTTCAAC
SMb20346TTACCTGGTTCTTCGCCTAAGCCTGGTGACATTCTC
SMb20347CCACGACGACCATTTCATGCCAACATCTATCGCTTC
SMb20537ACACCGTCGAAGCGTAATTCCTCAAGGTCGCAAATG
SMb20651ATGAAAGCCGAAATCCGCAAGGTCAAGGGCATTCGT
SMb21406AGGAAGATCAGGTCAAGGCGGTGTCAGATAATAGGG
SMb21448AACGACGATTGCCTCTCTTGGTGAGATAGCATTCCG
SMb21484rpoE5TCGCACGCAGTACAAGATTCCCTTATAGCTCATTCCGAACC
SMc02163pgiAATGACATCGGTTCCCTGCGGCTTCTACAATCGCAA
SMc0322416S rRNATCTACGGAATAACGCAGGGTGTCTCAGTCCCAATGT