TABLE 2.

Primers used in this study

Primer and purposeSequencea
To construct probes for S1 nuclease mapping
    agl3E/agl3R ForwardCGCTGCCGCCGCACGCGGTGGTCA
    agl3E/agl3R ReverseTGAGGTCCCCGTTGACGATGAGACC
    HrdB ForwardCGGCCGCAAGGTACGAGTTGATGA
    HrdB ReverseCCATGACAGAGACGGACTCGGCG
To amplify the promoter fragment for XylE fusions
    agl3E/agl3R ForwardTCGGCGTCCCGGAAGCTTCCGATGTCGCCG (wild-type sequence, AAGCGT)
    agl3E/agl3R ReverseGAGATAGGGGAGAAGCTTGTCGTTGTGCGA (wt sequence, GACCTT)
To construct deletion mutations
    SCO7167 UpstreamATCGCCTATCGATAGAACATAATCGATAGGGAGGGCGACATTCCGGGGATCCGTCGACC
    SCO7165 DownstreamTTCGCCCCGGTGGCGGGGATGTCGTGTCGTGCGCTCATGTGTAGGCTGGAGCTGCTTC
    SCO7162 DownstreamGCCCTGGTCCTGTGTCCACCTGTGGCCCGGCGCCCGCTGTGTAGGCTGGAGCTGCTTC
    SCO7168 UpstreamCCGCGTACACGCTCCGCTCAGCCGTGGCCGTGATCGTGAATTCCGGGGATCCGTCGACC
To confirm deletion mutations
    agl3R ForwardCGACCGGCTCACGACCGGCCCGCGA
    SCO7165 ReverseCGCCGGACGGCGGAGTCCCGACGGA
    SCO7162 ReverseAGGGCCAGGGCCAGGGCCAGGACCG
    P1ATTCCGGGGATCCGTCGACCTGCA
    P2TGTAGGCTGGAGCTGCTTCGAAGT
To construct His6-tagged agl3R protein
    His6-Agl3R ForwardTTGTTGTAGAAGACGAGGGA
    His6-Agl3R ReverseGGGGCGGCTCAGATCTCTT
For RT-PCR
    WhiB ForwardGTCGACGACGCGGACGAGGAA
    WhiB ReverseAGATGCCGAAGCGCTCGTCGT
    WhiG ForwardTGTGGCGGTCGTACAAGACGA
    WhiG ReverseATCGCGTACGTCTCGAACTTG
    WhiH ForwardAGCTGGGCCAGATGATCGTCT
    WhiH ReverseAAGGCACGCCATTCGATGATG
    WhiE ForwardTCTTCATGTCCGGCAACCGGA
    WhiE ReverseTAGAGCAGCCGCAGCCGTTCC
    SigF ForwardGGAGGTGCTGTCCTGCATCGA
    SigF ReverseGGAAACTACGTGCCAGTAGCC
    Agl3R ForwardACTGCTGTCCGACCAGGTGTA
    Alg3R ReverseCCGCGAACTCCTTCGATGATG
    Agl3E ForwardAACATCACACCGAACCTGACC
    Agl3E ReverseAGGGGAGGACCTTGTCGTTGT
    HrdB ForwardGCCTTCGAAGCTGACCAGATT
    HrdB ReverseCGGTCGCCTTCCTGCTGGTCA
  • a Underlining indicates the HindIII restriction site; boldface indicates altered bases.