TABLE 3.

Effect of ompA promoter spacer length on promoter activity in E. coli, F. johnsoniae, and F. hibernum

ClonePromoter structureaRelative promoter activityd
E. coliF. johnsoniaeF. hibernum
OmpA 17TTGATTTTGTATTTAAAAAATGGTGTTACTTTTGCTTGT282 ± 23 (91)831 ± 47 (10)160 ± 9 (3.9)
OmpA 18TTGATTTTGTATTTAAAAAATTGGTGTTACTTTTGCTTGT284 ± 26 (92)946 ± 17 (11)996 ± 12 (25)
OmpA 20TTGATTTTGTATTTAAAAAATTTTGGTGTTACTTTTGCTTGT285 ± 14 (92)1,932 ± 72 (23)901 ± 17 (22)
OmpA 21TTGATTTTGTATTTAAAAAATTTTTGGTGTTACTTTTGCTTGT301 ± 14 (98)1,256 ± 43 (15)835 ± 13 (21)
OmpA 22TTGATTTTGTATTTAAAAAATTTTTTGGTGTTACTTTTGCTTGT279 ± 11 (91)343 ± 2 (4.0)448 ± 7 (11)
OmpA 23TTGATTTTGTATTTAAAAAATTTTTTTGGTGTTACTTTTGCTTGT284 ± 19 (92)300 ± 3 (3.5)322 ± 3 (7.9)
Wild typeTTGATTTTGTATTTAAAAAATTTGGTGTTACTTTTGCTTGT311 ± 31 (100)8,479 ± 43 (100)4,088 ± 73 (100)
Negative controlbNAc197 ± 10 (64)57 ± 2 (0.7)36 ± 3 (0.9)
  • a The −33 (left) and −7 (right) sequences are in boldface. The spacer length was varied by inserting or deleting a T nucleotide(s) in the spacer region of the ompA promoter.

  • b Strains carrying pSCH144 (promoterless gfp) were used as a negative control.

  • c NA, not applicable.

  • d Relative GFP fluorescence in different strains was determined as described in Materials and Methods, and the promoter activity was normalized to that of the wild-type ompA promoter clone (defined as 100%), as shown in parentheses. Triplicate samples were used, and the standard deviations are shown.