TABLE 1.

Primers used in this study

PrimeraPrimer sequence (5′-3′)
cat1CAGGGTCGTTAAATAGCCGC
arb1GGCCACGCGTCGACTAGTACNNNNNNNNNNGATAT
cat2CCGTTGCTTCTCAAATGCC
arb2GGCCACGCGTCGACTAGTAC
yihO_AAGCCCAAGCTTAAAAAACCCATCCATGA
yihO_BTCTAATCATGATCCGCGTTAATTAATTAACGCCACTCACTTTACTTTACCCGTTAAAACA
yihO_CAGTAAAGTGAGTGGCGTTAATTAATTAACGCGGATCATGATTAGACATAATCGCCTCTCA
yihO_DTCGGCGGGCTGTTAATATGG
yihQE_AACCGTAAGCTTTTACGCCTGCGTTGCGC
yihQE_BAATTCTCTACCACAACGTTAATTAATTAACCTGCAAAACGACGACCTGCACCATAACCGT
yihQE_CGTCGTCGTTTTGCAGGTTAATTAATTAACGTTGTGGTAGAGAATTCATTGTAATCTCCG
yihQE_DTCGGTTAGATGCCGCCAGTG
agfD_AGACGAATTCGTGTGTTATGCCGCCATGGG
agfD_BGGACTGCAGTAAACATGATG
agfD_CGCCCTGCAGCAAACGATAATCTCAGGCGG
agfD_DGCCAAGCTTTGTCCGTGACGTTGAGCTGG
ΔPyih_AAGGGGAAGCTTGCTCTACTTGCTCCGCC
ΔPyih_BCGAAATGTTTAAAAAAAAAAAGCTGTCAATGTATTGACCCCCCCCCCCAAATACGAAAAAAAACCCCCCCCCCCCTGCTCATTAATGAC
ΔPyih_CGTCATTAATGAGCAGGGGGGGGGGGGTTTTTTTTCGTATTTGGGGGGGGGGGTCAATACATTGACAGCTTTTTTTTTTTAAACATTTCG
ΔPyih_DAGCCTGACGCGCCAGCGTAA
yihV1GCCCTCGAGCCGATAAATGCTATAACTG
yihV2GCCGGATCCCAAGCAATACGAACCATG