TABLE 2.

Characteristics of the plasmids and primers used in this study

Plasmid or primerRelevant characteristicsaSource or reference
Plasmids
    pEMcatColE1 derivative; Apr Cmr; carries a 1,303-bp-long minitransposon containing the IRs of the Himar1 transposon and ∼100 bp of Himar1 transposon sequences flanking the cat Cmr gene (magellan2)1
    pMV158GFPpMV158 derivative; Tcr; harbors the gene encoding GFP under the control of a maltose-inducible promoter53
    pR410pEMcat derivative; Apr Kanr; carries a 1,337-bp-long minitransposon containing the IRs of the Himar1 transposon and ∼100 bp of Himar1 transposon sequences flanking the kan geneJ. P. Claverys
    pR412ColE1 derivative; Apr Spcr; carries a 1,145-bp-long minitransposon containing the IRs of the Himar1 transposon and ∼100 bp of Himar1 transposon sequences flanking the spc gene48
Oligonucleotide primers
    MP127CCGGGGACTTATCAGCCAACC; mariner cassette universal primer; internal to IRs; outward orientation
    MP128TACTAGCGACGCCATCTATGTG; mariner cassette universal primer; adjacent to left IR; outward orientation
    cbpAmar3TCCGTACTGTCCAAGAAGCCA; downstream of cbpA (pspC) (accession no. AE008564)
    cbpAmar5GCAATGGCGGGAAAGAATTTGG; upstream of cbpA (pspC); (accession no. AE008564)
    pcpAmar3CAGAAGAAAAACGCTTGATCAGC; downstream of pcpA (accession no. AE008558)
    pcpAmar5GCAAATGCTGAGTAGGTTTCCC; upstream of pcpA (accession no. AE008558)
    pspAmar3TCCCAGTTCTTCATGAAGATACC; downstream of pspA (accession no. AE008396)
    pspAmar5CAAGTTGTTGCATCGTAGCTAAG; upstream of pspA (accession no. AE008396)
  • a IR, inverted repeat.