TABLE 1.

Strains, plasmids, phage, and primers used in this study

Strain, plasmid, phage, or primerCharacteristic(s) or sequenceSource or reference
Strains
    PAO1PrototrophLab
    WFPA12 algR::aacC1 36
    WFPA6 algR::aacC1/algR+ 36
    WFPA8 algR7 36
    WFPA21 fimT::aacC1 This work
    WFPA22 fimU::aacC1 This work
    PAO AWO pilA::tet Lab
Plasmids
    pEX18ApCloning vector 16
    pfimT fimT clone in pEX18ApThis work
    pfimU fimU clone in pEX18ApThis work
    pGMΩ1GEN cassette vector 16
    pBB21 fimT in pEX18Amp disrupted via GEN cassette; Ampr Gmr This work
    pBB22 fimU in pEX18Amp disrupted via GEN cassette; Ampr Gmr This work
    pmini-CTX-lacZ Integration vector; Tetr 16
    pP fimU -lacZ fimT-fimU intergenic region in mini-CTX-lacZ promoterless vectorThis work
Phage F116LTemperate, pilus-specific, generalized transducing phage 7
Primers used in assay
    Cloning reaction
        fimUEFEcoR5′-CCGGAATTCATGTCATATCGTTTC-3′
        fimUERHind5′-CCCAAGCTTGCATGACTGGGG-3′
        fimTEFEcoR5′-CCGGAATTCATGGTCGAAAGG-3′
        fimTINRBam5′-GAGGAGCCTCGGGAATCCGTTCCTTCT-3′
        fimTINFBam5′-AAGAAGGAACGGATTCCCGAGGCTCCT-3′
        fimTERHind5′-CCCAAGCTTTCATCCGGAAGTGCT-3′
        minictxF5′-CGGAATTCTGCTCTGCGGAAATAC-3′
        minictxR5′-CGGGATCCGCTGCTTGAAGTTCGGAATGG-3′
    DNA binding and footprinting
        NSF5′-CCCAAGCTTGAACCTCTTCCGCCGTCG-3′
        NSR5′-CCGGAATTCGTTGTTTGCTCTGCCGAT-3′
        algD33F5′-AGCCCTTGTGGCGAATAGGC-3′
        algD7R5′-AGGGAAGTTCCGGCCGTTTG-3′
        F1F5′-TTCTGCTCTGCGGAAGGCGGCATAC-3′
        F1R5′-GCTGCTTGAAGTTCGGAATGG-3′
        F2F5′-ACTTCCGGATGATCATGGAC-3′
        F2R5′-GGTCGAGTTGGAACGATATGA-3′
        F3F5′-GCTCTGCGGAAGGCATAC-3′
        F3R5′-GAAGTGCTGCATAGCTCACG-3′
    RT-PCR
        fimTF 5′-ATGGTCGAAAGGTCGCAG
        fimTR 5′-TCATCCGGAAGTGCTGCA
        fimUF 5′-ATGTCATATCGTTCCAACTCGACC
        fimUR 5′-TCAATAGCATGACTGGGGCGC
        pilVF 5′-ATGCTATTGAAATCGCGACAC
        pilVR 5′-TCATGGCTCGACCCTGAGG
        pilWF 5′-ATGAGCATGAACAACCGC
        pilWR 5′-TCATGGCACGAGATTCCTGAG
        pilXF 5′-ATGAACAACTTCCCTGCACAAC
        pilXR 5′-TCAGTTGGTATAGAGACGGGC
        pilY1F 5′-ATGAAATCGGTACTCCACCAG
        pilY1R 5′-TCAGTTCTTTCCTTCGATGGG
        pilY2F 5′-ATGAAAGTGCTGCCTATGCTGCT
        pilY2R 5′-TCATCGGGCCTGCTCC
        pilEF 5′-ATGAGGACAAGACAGAAGGGC
        pilER 5′-TCAGCGCCAGCAGTCG
        Primer A (411:430)5′-CGTTGCCTGG CAACTGATCC
        Primer B (435:452)5′-CCGGAGGGCCGGCTCCGTACCG
        Primer C (455:480)5′-CCGCGAGCGCCAGGGAGAACCGGGAG
        Primer D (499:518)5′-CTTCCGGATGATCATGGAC
        Primer E (570:600)5′-GCCCGTTTGGCATGCTTTCCAGGCGTAG
        Primer F (593:618)5′-CGTAGACCCCCTGGAGCAACCGC
        Primer G (702:721)5′-CATTCCGAACTTCAAGCAGC
    Real-time RT-PCR
        fimU2F 5′-CGTCCTGCTGGCCATCA
        fimU2R 5′-CTGCAGTTCGTTGCGTTCTG
        fimU2P 5′-[DFAM]CGCCATTCCGAACTTCAAGCAGGCT[DTAM]
        pilEF 5′-GCATCGCCATTCCCAGTT
        pilER 5′-CCTCGGTGCGGGTTGA
        pilEP 5′-[DFAM]CCAGAACTACGTGGATCC[DTAM]
        pilV2F 5′-TGCTATTGAAATCGCGACACA
        pilV2R 5′-CGACCAGCACTTCGATCATG
        pilV2P 5′-[DFAM]TCGCTGCACCAATCCGGCTTC[DTAM]
        rpoDF 5′-CCTGGCGGAGGATATTTCC
        rpoDR 5′-GATCCCCATGTCGTTGATCAT
        rpoDP 5′-[DFAM]ATCCGGAACAGGTGGAAGACATCATCC[DTAM]