TABLE 1.

Primers used for mutant construction by recombinant PCR

PrimerCoordinateaLength (no. of residues)Sequence (5′ → 3′)b
486-1b51764521CATCACGGGCATTCACACTAG
486-2b51697620CCTTTTGCAGCGAATAGTGG
486-3bKnHybrid primer42 CCACTATTCGCTGCAAAAGGAGCTACTGGGCTATCTGGACAA
486-4bKnHybrid primer41 GATGATGGGAAAGGTGTTCACATCGCTTGGTCGGTCATTTC
486-5b51589221GTGAACACCTTTCCCATCATC
486-6b51541319ATAGCATCGCCGATCTGTG
1798-1b196519620GGATATTTCCTTCCTCGTGG
1798-2b196458919GACAATTCCTTCGCTGACC
1798-3Gm2Hybrid primer40 GGTCAGCGAAGGAATTGTCACATAAGCCTGTTCGGTTCGT
1798-4Gm2Hybrid primer41 GGTGCTCATAGGTTTCAGGAACGGCTTGAACGAATTGTTAG
1798-5b196431920TCCTGAAACCTATGAGCACC
1798-6b196372820TCCACACTGTCCAGAAGAGC
  • a Negative strand nucleotide position.

  • b Hybrid primers are composed of G. sulfurreducens sequences and antibiotic resistance cassette sequences. The underlined sequences in primers 486-3bKn, 486-4Kn, 1798-3Gm2, and 1798-4Gm2 correspond to the reverse complements of primers 486-2b, 486-5b, 1798-2b, and 1798-5b, respectively.