TABLE 2.

Primers used in this study

PrimerSequencea
Deletion constructs
    lacZ
        lacZ5′FACGCGTCGACGCCAGCAATACCCCATTTAGC
        lacZ5′RCGGGATCCAATTTCAGCCTTATCTTTTACGAAAGTTAGC
        lacZ3′FCGGGATCCGCAACAATATCAACACAGAATTTCTAATACGC
        lacZ3′RATAAGAATGCGGCCGCTGCTGGGCTATAATCTGGTGC
    leuO
        leuO5′FACGCGTCGACGGATTGGTTCATGCTTCTTATATTTTATGGCT
        leuO5′RCGGGATCCTACTAAGTTGTGTTCAAACATGCTTAACTCCAC
        leuO3′FCGGGATCCTAGTTATTATCATTAAGTCCTGCTGCTGAAGTTG
        leuO3′RATAAGAATGCGGCCGCACGCTCTTGGATGGCAGC
    rpoS
        rpoS5′FACGCGTCGACTGTCGCTACAACCGCACC
        rpoS5′RGGAAGATCTCATATGCTGCTCCTACCCGTG
        rpoS3′FGGAAGATCTTAGCGATACTCTCGCAAACAGTCTG
        rpoS3′RATAAGAATGCGGCCGCCCGTATCAAAGCCATGACGCTA
Reporters
    rovA::lacZ
        rlacZFTGCTCTAGAGGGTCAATGACAAATAATAAGCCTCCAGT
        rlacZRCGGGATCCACCAATCGCTTTCGCCAGTTG
    rovA::gfp
        pYELFCGGGATCCTGGTTATCATGAACTAATATTTTAACCAATCGGC
        pYESFCGGGATCCAGGGGGATTGCATATAATAATTCCACA
        pYEL-2RGGAATTCACCAATCGCTTTCGCCAGTTG
        pYPLFCGGGATCCTGCCGCCTTCCTGCAA
        pYPSFCGGGATCCTTTGAAATATTGATGATTCATATCAATTTACCCAAGTC
        pYPL-2RGGAATTCACCAATCGCTTTCGCCAGTTG
Complementation clone: pLEUO
    pLEUOFACGCGTCGACGGATTGGTTCATGCTTCTTATATTTTATGGCT
    pLEUORGGGGTACCTTAAGAAGGAATATTAAGCTGGCTGAGTAATTC
Primer extension
    PE1CTAATCGTGCTAAATCAGATCC
    PE2AAAATTATGTATTTACTAAAATTACCTCTTAAGGA
EMSA
    YP1-2FTGC CGC CTT CCT GCA A
    YP3-4FTTTGAAATATTGATGATTCATATCAATTTACCCAAGTC
    YP1-4RACCAATCGCTTTCGCCAGTTG
    YP2-3RGGACAATAGCAATAAATACGGGGAA
    YE1-2FTGGTTATCATGAACTAATATTTTAACCAATCGGC
    YE3FAGGGGGATTGCATATAATAATTCCACA
    YE4FATTTAAGAGACTGATGATTCATATCAATTTACCAAC
    YE5FTTGGATGCCAGATATCACCC
    YE6FACCTAGCATAACCGCCTTAAAAATT
    YE1-4-5-6RACCAATCGCTTTCGCCAGTTG
    YE2-3RGGACAATAGCAATAAATACGGGGAA
Transposon sequencing
    TNFCCCATGTCAGCCGTTAAGTGT
  • a Underlining indicates restriction sites.