TABLE 1.

Sequences of oligonucleotides used in this study

PrimerGene targetedSequence (5′→3′)cSize of amplicon (bp)Description or reference
PG1051F1aPG1051ACGTTTTCGGTTCGGTTCGAllelic exchange
PG1051R1 (SstI)PG1051atatatgagctcATTCCGTTCTTGTCGGACG505
PG1051F2a (XbaI)PG1051atatattctagaATCTTCAACGGCCTCTTGTCAllelic exchange
PG1051R2PG1051TTTCGAGTCGGAGAAACGG385
PG1050F1b (NotI)PG1051atatatgcggccgcCGTTTGCGTTGCAGTACGG
PG1052R1 (NotI)PG1051atatatgcggccgcGGATGAGCCGCACCATTTC2,161Complementation
RTPG1050F1PG1050CACGAGGCATACGAGCATG562Expression
RTPG1050R1PG1050TCCGAAGAGCATGTCCCTC
RTPG1051F1PG1051TTGTTGTTGCTGCGGTAGG1,062Expression
RTPG1051R1PG1051TTCGACTGCCATTGTCAGG
RTPG1052F1PG1052GTTCGATCTGCCGGATTCC209Expression
RTPG1052R1PG1052CATTGGTCGATGGCATCAC
ErmFR2ermFTTCGTTTTACGGGTCAGCAC
ErmAMR2ermAMACTTTGGCGTGTTTCATTGC3
  • a Ligation of these amplicons to the erm cassette leads to a deletion of 464 bp within the 1,416 bp of PG1051.

  • b Incorporates PG1051 and flanked partly by regions of PG1050 and PG1052.

  • c Lowercase type indicates irrelevant sequences to facilitate restriction digestion following DNA amplification, and boldface type corresponds to restriction sites.