TABLE 1.

Strains, plasmids, and primers used in this study

Strain or plasmidRelevant characteristics or sequenceaSource or reference
Strains
    E. coli
        TG1 E. coli general cloning host 16
        EC1000 E. coli cloning host for repA-dependent plasmids; carries constitutive repA allele on chromosome; Kanr 8
    E. faecalis
        OG1RF E. faecalis Fusr Rifr; p-Cl-Pher 11
        CK111/pCF10-101 E. faecalis conjugative donor strain; carries constitutive repA allele on chromosome and nontransferable pCF10 derivative; Spcr Tetr 7
        DAGF27Tn917 transposon insertion at +581 bp from the ebpR a ATG in OG1RF; Ermr Fusr Rifr 5
        TX5475 ebpA allelic replacement aph(3′)-IIIa mutant of OG1RF; Fusr Kanr Rifr 13
        TX5460 ebpB insertion disruption mutant of OG1RF; Fusr Kanr Rifr 13
        TX5448 ebpC insertion disruption mutant of OG1RF; Fusr Kanr Rifr 13
        TX5514 ebpR in-frame deletion from bp −5 to +1337 from the ATG of ebpR of OG1RF; Fusr Rifr; p-Cl-Pher This study
        TX5584TX5514(pMSP3535); Ermr Fusr Rifr; p-Cl-Pher This study
        TX5582TX5514(pTEX5515); ebpR mutant containing ebpR gene inserted into pMSP3535; Ermr Fusr Rifr; p-Cl-Pher This study
        TX5590OG1RF(pTEX5586); OG1RF containing the ebpR promoter fused to lacZ; Ermr Fosr Rifr This study
        TX5591TX5514(pTEX5586); ebpR mutant containing the ebpR promoter fused to lacZ; Ermr This study
Plasmids
    pMSP3535Nisin-inducible expression shuttle vector with pAMβ1 and ColE1 replicons; Ermr 3
    pTCV-lacZ Shuttle vector containing promoterless lacZ; Ermr 14
    pTEX5515pMSP3535 with ebpR from bp −20 to +1561 from the ATG; this ebpR fragment contains the full ORF and the RBS of ebpR; Ermr This study
    pTEX5586pTCV-lacZ containing 301 bp from bp 248 upstream to bp 53 downstream of the start codon of ebpR; Ermr This study
    pTEX5269pTCV-lacZ containing 103 bp from bp −110 to −8 of the start codon of fsrB; Ermr 26
Primers
    ebpR deletionUpstream fragment was amplified using GC TCTAGA CAGGACCCACACTTTTCA with CG GGATCC TTTCCTCCCAAGTCCTTT, and the downstream fragment was amplified using CGGGATCCTTGAAACCAGTGTTCCAAG with GGAATTCTGGTCAGCAAACGATTTT
    ebpR complementationThe primers CC GAGCTC GGACTTGGGAGGAAACAATA and CG GGATCC AAGTCATTTCGACTTATGTCCT were used to amplify ebpR from 20 bp upstream of the start codon to 138 bp downstream of the stop codon
    ebpR promoter fusionThe primers GGAATT CAAGACTACGCCGAAAACC and CG GGATCC ACACGAATGATTTCTTCCA were used to amplify from 248 bp upstream to 53 bp downstream of the start codon of ebpR.
    Quantitative RT-PCR primers gyrB, ACCAACACCGTGCAAGCC and CAAGCCAAAACAGGTCGCC; ebpA, AAAAATGATTCGGCTCCAGAA and TGCCAGATTCGCTCTCAAAG; srtC, ACACATGCGGTCATTTCAGG and GCGTCTTCCCATTGACTTCG
  • a ORF, open reading frame; RBS, ribosome binding site. ebpR = ef1090. Kanr, kanamycin resistance; Fusr, fusidic acid resistance; Rifr, rifampin resistance; p-cl-Pher, p-chloro-phenylalanine resistance; Spcr, spectinomycin resistance; Tetr, tetracycline resistance; Ermr, erythromycin resistance. Restriction enzyme recognition sites are underlined.