Table 2.

Putative CRP binding sites

Flanking genesaLocationbSequencec
nadC and ampD118698–118719ATATGTGGTGCTAATACCCGGT
yaeP and yaeQ214196–214217GAGTGTGGTATAGTCACCTTGC
ybiS and ybiT855062–855083AAATGTGATTTCGTACACATCT
ycfQ and bhsA1168209–1168230GTATGTGATCCAGATCACATCT
yeiW and yeiP2263384–2263405GCAAGTGGTATTCGCACTTTTG
aegA and narQ2583588–2583609ATGAGTGTTGTTATTACCCGAC
aaeX and aaeR3387505–3387526AAAAGTGATTTAGATCACATAA
ConsensusAAATGTGATCTAGATCACATTT
  • a Consensus CRP binding site (3) is also shown.

  • b Genomic region encompassing the putative CRP binding site in the corresponding intergenic region. Numbering is according to nucleotide positions in E. coli K-12.

  • c MG1655 genome sequence (GenBank accession number NC_000913.2). Nucleotides where the CRP homodimer makes contact are in bold.