TABLE 1.

Bacterial strains, plasmids, and oligonucleotides used in the current study

Bacterial strain, plasmid, or oligonucleotideRelevant characteristics or sequenceSource or reference
Strains
    E. coli DH5αF φ80/lacZΔM15 Δ(lacZYA-argF)U169 rec endAI hsdR17Laboratory
    A. tumefaciens
        C58A136 containing the nopaline Ti plasmid pTiC58 stockLaboratory
        CB1001C58 with a precise, nonpolar deletion of virB1 from pTiC58
Plasmids for expression in A. tumefaciens (protein)
    pDW029Strr Spcr; BHR vector with nopaline virB promoter and consensus RBSThis study
    pDW101 (VirB1)pDW029 derivative; vir-regulated expression of full-length VirB1This study
    pJZ034 (VirB1-LT)pDW029 derivative; vir-regulated expression of VirB1 lytic transglycosylase domainThis study
    pJZ036 (VirB1*)pDW029 derivative; vir-regulated expression of VirB1*This study
    pJZ038 (VirBΔSP)pDW029 derivative; vir-regulated expression of VirB1 without SPI signalThis study
    pJZ040 [VirB1(AA/PR)]pDW029 derivative; vir-regulated expression of VirB1 in which the VirB18 processing site at aa 179 to 80 changed from AA to PRThis study
    pJZ042 [VirB1(E/Q)]pDW029 derivative; vir-regulated expression of VirB1 in which the glutamic acid (aa 60) in lytic transglycosylase catalytic site changed to glutamineThis study
    pJZ71 (VirB1-B2)pDW029 derivative; vir-regulated expression of wild-type VirB1 and VirB2 from wild-type, overlapping coding sequencesThis study
    pJZ076 [VirB1(Q/S)]pDW029 derivative; vir-regulated expression of VirB1 in which glutamine (aa 182) changed to serineThis study
    pJZ079pDW029 derivative; vir-regulated expression of octopine VirB1 with a hemagglutinin epitope tag at the carboxy terminusThis study
    pJZ093pDW029 derivative: vir-regulated expression of octopine VirB1 with a hemagglutinin epitope tag inserted between aa 188 and 189This study
Yeast two-hybrid plasmids
    pC-ACT.2.B2Full-length VirB2 in pC-ACT.272
    pC-ACT.2.B2mVirB2 (aa 48 to 121) in pC-ACT.272
    pC-ACT.2.B2(95-121)VirB2 (aa 95 to 121) in pC-ACT.272
    pACTII.B5ΔSPVirB5ΔSP in pACTIILaboratory stock
    pCD.1.B1Full-length VirB1 in pCD.172
    pAS2.VirB1ΔSPVirB1ΔSP in pAS2Laboratory stock
    pCD.1.B1*+44VirB1*+44 in pCD.1This study
    pCD.1.B1*VirB1* in pCD.172
Additional plasmid
    pGK217Template for VirB1 PCR48
Oligonucleotides
    B1*F0295′-TCGACCTAGGTTCGCGAACGGCTACGTG-3′
    B1*R0295′-GTTGCCTAGGAGCGCATTCGCGTGCAAA-3′
    B1no*F0295′TAATCCTAGGCAACAGCTCGTCCCCCCGTTAACC
    B1no*F0295′-CTCACCTAGGCGTTTCAACTTTTCGCAC-3′
    B1QtoS.F5′-CTCGTCCCCCCGTTAACCGCG-3′
    B1QtoS.R5′-GGATTGAGCGGCCGTTTCAAC-3′
    CH0105′-GCGACTGCAGTTATTGCGGACCT-3′
    CH0135′-GATGCCTAGGCTTGCTTGGGAGCCGCTA-3′
    DWB1Bs1655′-ATCGATCATGAGCTTGGGGAGATTGGGAATG-3′
    DWB1P_1405′-GCGACTGCAGATCGCATTATTGCGGACCTCCTTG-3′
    LysE60QF0295′-CTCCGTCGACGCTTGCAGCGATCGCTCAGGTCCAAAGTCGCTTTGATCCGC-3′
    LysE60QR0295′-AAGCGTCGACGGAGCAACGGATGGAGC-3′
    LysF0295′-GTTGCCTAGGGAATTCCTGCAGCCC-3′
    LysR0295′-TCGGCCTAGGTCAGGCCGTTTCAACTTTTCG-3′
    MTX195′-GGAACCTTGAGCTAAGGAGATAAGG-3′
    OctB1HA.R25′-GAACTGCAGCTCCTTACGCATAATCCGGGACATCATACGGGTATAAGTCGAATAAGACTTG-3′
    FOctB1NcoI5′-CCATGGTTAAGAGATCGGGGTCGC-3′
    5OctB1IntHA.R5′- CGCATAATCCGGGACATCATACGGATAATCGTCTTGCGGAGGCTCGATTAA-3′
    3OctB1IntHA.F5′-TATCCGTATGATGTCCCGGATTATGCGCACAAGGCACTAAAATCGGAAGAT
    3OctB1IntHA.R5′-CGGAACTGCAGCACCTTAGTATAAGTCGAATAAGACTTG-3′
    SPF0295′-AGAGTCATGATGGAGTTCAATAATTTTGCACGC-3′
    SPR0295′-AGTAAGATAATCGACAGC-3′
    VirB1.5.BspH5′-TTGGTCATGAGCTTGGGGAGATGGGGAATG-3′