TABLE 2.

Oligonucleotides

DescriptionPrimeraSequence
Oligonucleotides used for promoter constructs
    P3 sae promoter with a short upstream regionsaeP3UGTCGACGAATTCTCGTGTGGGTTCAGGTATTGTTATG
saeP3LGTCGACGAATTCACCTCTGTTCTTACGACC
    P3 sae promoter with a middle upstream regionsae974UCCGGCGAATTCCTTAAGCAACCCATGAGC
saeP3LGTCGACGAATTCACCTCTGTTCTTACGACC
    P3 sae promoter with a long upstream regionsaeP2UGTCGACGAATTCACTGTTGAAGGTAAAGCTG
saeP3LGTCGACGAATTCACCTCTGTTCTTACGACC
    P2 sae promoter with a short downstream regionsaeP2UGTCGACGAATTCACTGTTGAAGGTAAAGCTG
saeP2LGTCGACGAATTCCCTGAACCCACACGAATGATAAATG
    P2 sae promoter with a middle downstream regionsaeP2UGTCGACGAATTCACTGTTGAAGGTAAAGCTG
sae1258LCCGGCGAATTCGCGAAAAACCACTTATAC
    P2 sae promoter with a long downstream regionsaeP2UGTCGACGAATTCACTGTTGAAGGTAAAGCTG
sae1269CCGGCGAATTCCAACTATATTTGCGAAAA
    P1 sae promotersaeP1UGTCGACGAATTCTTATTGTGGCAAAAGGTT
saeP1LGTCGACGAATTCTACCTTGATCTTGTGAAT
    lacZ controllacZLCGGATTGACCGTAATGGGATAGG
Oligonucleotides used for sae cloning in pCL84
    sae complemention with a short fragmentsae-1066UCAATAAATAGAAAGAATGTGA
sae-3515LATTATTAGGCGGCATACAG
    sae complemention with a middle fragmentsae-724UATCTTCGGCGGCGCTAAA
sae-3515LATTATTAGGCGGCATACAG
    Full-length sae complementionsae-1UTTATTGTGGCAAAAGGTTT
sae-3515LATTATTAGGCGGCATACAG
  • a U, upper primer; L, lower primer.