TABLE 2.

Primers used in this study

PrimerSequence (5′-3′)aPurpose
vacB-NATGATCCTCGACCTCATCAAGGGCCATGAAPCR amplification of a portion (2.0 kb) of the vacB gene
vacB-CTCACGAAGTCGATCTTGCGATCGTCCAGAT
vacB-N1TGCTGGTCTCGGCGAACAGGTGCCGDNA sequencing of the PCR product to obtain middle part of the vacB gene
vacB-C1CACCAGACCGTCGATGTGGATCTCG
vacB-N/TGACTCACCAACGACTACTACCAGTTCGACCCGDNA sequencing of the gDNA to obtain the ORF of the vacB gene
vacB-C/ATGCAGTTGACCGTCGCGCTCCATGGCGCGCAG
vacB-N/upGTCTCATCATGACTGCAAACTGTGCATAGTATGACCloning of the vacB gene into pCR2.1 vector
vacB-C/downGGGGCCATCAGCCCCTTACGACCTCAGACCGGGTC
vacB-N/gGAACGCCTGCTTGAGATAGGCGGCGGATTGGGCGAPCR verification of the vacB mutant
vacB-C/gAGTAACAGGGTTCGGATTTTTTTCGTTTTCAGGAC
vacB/HindIIINCCCAAGCTTGTCTCATCATGACTGCAAACTGTGCACloning of the vacB gene into pBR322 vector
vacB/SalICACGCGTCGACGGGGCCATCAGCCCCTTACGACCTC
vacB/AflIIINCCCACATGTCTCAAAAAGATCCTTTCCTCGAACGCGAGGCCloning of the vacB gene into pBAD/Thio-E vector
vacB/PmeICAGCTTTGTTTAAACTTACCCCTTGGCCTTGTCGCGCGCTT
  • a Underlining indicates restriction endonuclease site.