TABLE 2.

Oligonucleotide primers used in this study

Target genePrimer namePrimers sequence (5′-3′)
srtASAsrtA1CCGTCCATATCTACCGCAAT
SAsrtA2ATGAAGTCAATGCTGCGATG
srtASAsrtAcomp1CGGTATACATTGCCGCTTCT
SAsrtA4comp2ATGCGACACGTTCGTCTATG
clfASAclfA1ATTCGGCAACAGAAGAGCAT
SAclfA2TTTCGCCAAGCCAAATTAT
fnbBSAfnbB1AACATGCCGTTGTTTGTTGA
SAfnbB2AATGTCGGCTTGAAATACGG
fnbBSAfnbBFORCGCGGATCCGTGGAAGTAGAAGAAGGTAG
SAfnbBREVGACGCGTCGACTTAATTAGGTTCCTTTAGTTTATC
fnbASAfnbAFORCGCGGATCCGGTACAGATGTAACAAGTAAAG
SAfnbAREVGACGCGTCGACTTAATTCGGACCATTTTTCTCATT
gyrBSAgyrBFORTTATGGTGCTGGGCAAATACA
SAgyrBREVCACCATGTAAACCACCAGATA
fnbAN304AFWDCGGCTGAACTAGAAATTGCTTTATTTATTGATCC
N304AREVGGATCAATAAATAAAGCAATTTCTAGTTCAGCCG