TABLE 1.

B. bronchiseptica TonB-dependent receptor genes

Locus tagGene name and/or referencePrimer sequencea (5′→3′)
BB0078bfrC (6)GGCCGAATTCGCCGGTGCGCAACGACAATGAC
GGCCAAGCTTCGCGGCCGCCACGAACT
BB0189This studyGCGCGGATCCTGCCCGGCCACAACCACGAGT
CGCGGAATTCTGCGGCGCGAAGTCCCAGATG
BB083241GCGCGGATCCCGTAGCGCCGGCCGAACAGGT
GCGCGAATTCCGCCGCGGCTACGACAACTACA
BB1294bfrG (41)GGCCGAATTCGCCGACCGCGATTTCCAGA
GGCCAAGCTTCGGCGCGGCGTGTTGACC
BB1785bfrI (41)GGCCGAATTCCGGCGGCGTGGTCAACCTCGTCAG
GGCCAAGCTTGGTGGCGTTGTCGGTTTCCTTGTC
BB1846bfrB (6)GGCCGAATTCGTATTTCATCCGCGGCTTCATCCT
GGCCAAGCTTCGGCGGCGGGCGAGTTGTGG
BB190541CCGGGGATCCGCCGCGCTCGTCCGTCTATGTGTC
GATCCGTGGCGTCCGTGAACTG
BB1942bfeA (8)NAb
BB2179This studyCGCGGAATTCACACATAATCGGCCCGTTCCACA
GCGCGGATCCCCCGGTCAGCCATGCCTCCTA
BB3658bfrH (41)GGCCGAATTCCCGGCGGGTCAACATGGATTTTTC
GGCCAAGCTTCCCGGCGGCTGGTATTTCACG
BB3825bfrE (41)GGCCAAGCTTGCGGCGGGCAGCATCTTCGTC
GGCCAAGCTTTTGTCTTCGCGGCTGGTGCTGTAG
BB3826bfrD (42)GGCCGAATTCGTCAGCCGCCGCAACTTCTACG
GGCCAAGCTTCGGCGACTTCGATGCTGGTGTT
BB3900fauA (10)NA
BB4122bfrF (41)GGCCGAATTCCAGCGCGATGTCCGAACCCTACG
GGCCAAGCTTGCGGCCGCTGAGCACCACCAC
BB4457This studyCGCGGAATTCCTCAACGGCCAGCGCATCAACAA
GCGCGGATCCGCCGGTGGGGGTGCTCATCTG
BB4655bhuR (55)NA
BB4744bfrZ (44)GCGCGAATTCCGGGCGGCATCGTCAACTACACCT
CTTGCTGCGGCCCTGCGAGAACG
BB4761bfrA (7)GCGCGAATTCGCGCGGCCCTATGTCCACCCTG
GCGCGGATCCCTCCACTTGCCGCCGAACTGCTC
BB4956hemC (41)GCGCGAATTCGGCACCCGCTTCGCATACTCG
GCGCGGATCCCGCGCCGCCTTCCAGACCAC
  • a Primer sequences for PCR amplification of internal gene fragments used in the construction of insertion mutations.

  • b NA, not applicable.