TABLE 1.

Oligonucleotides used in this study

ORFPrimer nameaOligonucleotide sequence (5′→3′)Start in sequence (5′→3′)b
orf371 371_fwTGACTTCCAATGTACCGACA161
371_rvGCTGCTGCGACTAACACAC830
orf418 418_fwCTAACTGGTAACTATGGCTTGT121
418_rvGTCCGTGCTGTCACTTGT1230
orf773 773_fwGCATCAGTCATTAACCAGAGTA139
773_rvCCCTGTCAAAGGAATAACG1050
orf884 884_fwAATCAGACAGTCCACACAGAG61
884_rvATGATTCCGCTCCACAGTA1229
orf903 903_fwTCAACGGACATACCATACCA311
903_rvTCAGTTGGATTCCATGTGAT1400
903_rv2CTTACCATCAACGATCTGCC720
orf904 904s_fwAGACGAGGAAGAGGGCAT360
orf905 905_fwGTGACAGATTCATCTAATCAT1
905_rvTCATTTTATTTCCCTCCTATTG1005
905_rv2GTGTGAAATGTATGAATCTTGTC281
905s_rvCTTTGGATACAAGTGGATGG51
orf906 906s_fwGACACAGCAGTTCCAGCA271
orf907 907_fwGTGACCGGTTTTGATGAAAAC1
907_rvTTAAGCTTCTGTTTCTTGATGGC816
907_rv2GTTGTATTTTCCCGATTGAC290
orf1901 1901_fwCCGTCAAATCCAATCCAG121
1901_rvCAGTACCTTGACCAAACTTCG940
orf1904 1904_fwAGGCAGATTATGGTGATGTT251
1904_rvGGCTGTTGGTTCTTTATCTG870
orf1996 1996_fwTGAAGTTGCTGCTAACGAAC81
1996_rvGCAACTTCGATTCCTTCTAC1040
orf2008 2008_fwCTACGGATTTTGGTGAAGAA191
2008_rvTCGCACTTCTATTTCCTGAT900
orf2009 2009_fwGCTTGGCTATCTCTGAGGA182
2009_rvTCATAGGCAGAGACTGGAAC1100
orf2010 2010_fwGTAGCGAAGAAAATGAGATGG80
2010_rvTAACTTGACTGAATCGGTGC1101
orf2109 2109_fwGCAGGTGCAACTTATACATTAG61
2109_rvCTTGATCCGTCGTAATATTGA811
orf2351 2351_fwAATGAACGGGCAAATGAG82
2351_rvCTTTTGTTCCTTAGTTGGTATGA753
orf2356 2356_fwGTTGGTCATCTTATTTGCTGTA30
2356_rvTGCCCTGCTCCTTCTACTA1370
orf2430 2430_fwGCAGTTTACAATGGTGTGAAGCAA217
2430_rvCGGCTAATGAGTATTTGTCGTTCC1180
2430_rv2AGAACCCTCAGTTTCCACAT840
orf2514 2514_fwAGTTCCAGTTGCGAGTCAGA131
2514_rvATGTAGTCGGATTCGGTGC1120
orf2515 2515_fwGTGGTAGAATTGACGAAAGA1
2515_rvAACAAGTAGCACACCCAATA990
orf2569 2569_fwGTGTTTGCAGAGGAGACAGC61
2569_rvGACAGAATAATTTACTGGGTCG1182
orf2570 2570_fwGGTAGCAACAGAAACAGAAAC66
2570_rvGAATACTGCGCCAGCTAATC1026
orf2571 2571_fwATGACGACCACAGGGAAGAA1
2571_rvCCGCTATCTGCTAAAGTATC980
ddl ddl_fwGAGACATTGAATATGCCTTATG334
ddl_rvAAAAAGAAATCGCACCG893
  • a Annotation: fw, forward; rv, reverse.

  • b Relative to the start codon of the open reading frame.