TABLE 1.

Primers used in this work

PrimerSequencea
735′ TCAGCTGGTCTGGATTTTCC 3′
745′ GCTAGGGCGTGAGATGATTC 3′
795′ ATCACGATGATTGGCAACAA 3′
805′ AACTGCTCCCCATTGCTCTA 3′
1095′ ctactagcatATGTTAAATGCAAATCCTGTCG 3′
1105′ ctactagcatatgTAAGCTTTTATCGTGAGGGGC 3′
1125′ GGATTTGTCCTAAAAATTGCTG 3′
1135′ ctactggctagcGTCCATATAACCAATACTTTGG 3′
1145′ ctactggcggccgcTAAGTCAAGGTTTTTCGAGTTC 3′
1155′ ctactggcggccgcTGTTAAATGCAAATCCTGTCG 3′
1165′ ctactggagctcCTGCTATGATTATAAGCTGAC 3′
1175′ ctactgggtaccAAGAGTCTCTATATTAAGTGG 3′
1195′ ctactgggtaccGGAGATATCTATATCAACCTC 3′
1235′ GCCATCACATAAGCATGCTC 3′
1245′ AGCAGCACCTAAACCGAAAG 3′
1255′ ATTCCAGGCATTTACTGGTAG 3′
1325′ TAGATGATTTAAGGTCAAATAGATAAAGTAG 3′
1365′ TATCTCTTTTAATACAGAAAAACCAC 3′
1375′ TTACCAAGCTTTGAAGCAAGCG 3′
1385′ TAGTTTGGTCGATTATTCAGTAGC 3′
1525′ ctactggctagcTTGTATGGATTAGTCGAGC 3′
1535′ ctactgagatctGACGAATGTTCATAACAATCTTAC 3′
1615′ ctactggctagcATAATTAGACTCTAAGTAC 3′
1625′ ctactgctcgagTTCTGGATAGTGATTATTGC 3′
1655′ GACAAAAGCGTTACCCAAAGAG 3′
1785′ GCTTGTTTGCCTACTTTAGGAGG 3′
1825′ GATTTGTGCTGTTATAGCTTGC 3′
1845′ TGGGAGATCATCATCAGGG 3′
1885′ TGGGCAACAACAACCAATAA 3′
1895′ TGGTGAAGCGGTTAATGTCA 3′
1975′ ctactggctagcAACAGATATACTGGTTAATC 3′
1985′ ctactgtccggaAAAGGGGGTAATTGATAATAC 3′
1995′ ctactgtccggaACAATAGATATGGCTGTATATC 3′
2005′ CAAACTGTTTTAAGAGCTCG 3′
2015′ CAACAAACTGGATATTTGTTTG 3′
2045′ CGATAATAAATATCAATTATCATTCGG 3′
2065′ ctactggctagcGTGGTTTTTCTGTATTAAAAGAG 3′
2075′ ctactgggatccTTAAAGATATACAGCCATATC 3′
2115′ GTAAGCTTTATTTGATTTCCAG 3′
2195′ ctactgggatccAAACTCTAATGAACAATCGC 3′
2245′ ctactgtctagaTTAAAGATATACAGCCATATC 3′
  • a Uppercase letters correspond to Francisella genomic sequences; lowercase letters indicate nucleotides added to the primers.