TABLE 2.

Oligonucleotide primers used in this work

Purpose of oligonucleotide primerName of oligonucleotide primerSequence of oligonucleotide primera
tnrA::Tn917 and ccpA::neo transferTNRA-FATAGAGTTTTTCAGAATAATGGCGTCG
TNRA-RGCATTATCAGCTATTTTGAAGACGCGC
CCPA-FAGAAACGCATTTGCCAGTCTTTGTTG
CCPA-RTCGGTGCCGTTCCTCCATTGCTGCGA
Random base substitutionD-248F3GCGCTCTAGATGATCTGTCAGACTCAATCCAT
D+26RRGATGATTTGGATCCGTGAAGCTTGCATTTATCTTTTGTNNNNCTCATA
Construction of strains FU895, FU904, and FU905D-55FGCGCGCGCTCTAGAAATAATTTTAAAAAATGCTG
D+26R (GA)GCGCGGATCCGTGAAGCTTGCATTTATCTTTTGTTCAA
D+26R (GG)GCGCGGATCCGTGAAGCTTGCATTTATCTTTTGTCCAA
D+26R (CG)GCGCGGATCCGTGAAGCTTGCATTTATCTTTTGTCGAA
Primer extensionPEpFCCAGTTAAAGGATTTGAGCGTAGCGAAb
PEpRTCCACAGTAGTTCACCACCTTTTCCCTATAb
In vitro transcription (D-55F/ITlacZ-R)ITlacZ-RCAGGAAACAGCTATGACCTGCGGGCCTCTTCGCTATTA
  • a Underlining indicates restriction enzyme sites.

  • b Sequence from plasmid pCRE-test2.