TABLE 1.

Strains, plasmids, and primers used in this work

Strain, plasmid, or primerGenotype, relevant characteristics, or sequence (5′-3′)Reference, source, or use
P. aeruginosa strains
    PAO1Laboratory strain, completely sequenced36
    PAOMSPAO1 ΔmucS::loxSubmitted for publication
    PAOMAPAO1 ΔmutA::loxSubmitted for publication
    PAOMSAPAO1 ΔmutS::lox ΔmucA::loxSubmitted for publication
E. coli XL-1 BlueF′::Tn10 proAB lacIq Δ(lacZ)M15 recA1 endA1 gyrA96 (Nalr) thi hsdR17(rK mK) mcrB1Laboratory collection
Plasmids
    pUCP24Gmr; pUC18-based Escherichia-Pseudomonas shuttle vector41
    pJMMLmutL from PAO1 cloned in pJMS6αlac25
    pUCPMSmutS from PAO1 cloned in pUCP2426
    pUCPMLmutL from PAO1 cloned in pUCP24This study
Primers
    mutSF1TTAACATTACCCTCTTTTGCAC (−50 to −29)aAmplification and sequencing of mutS
    mutSR1TCATTTTCTAGTTCTCTCCTCA (2637 to 2616)Amplification and sequencing of mutS
    mutSF4CGCTCCGCTCCAGGACAGCGC (1611 to 1633)Sequencing of mutS
    mutSF5CGGCTGCCTGCTCGCCTAC (701 to 719)Sequencing of mutS
    mutSF6CATTCGGCGGAGGGCTACCTG (210 to 230)Sequencing of mutS
    mutSR6TGGCGGTTTCGCTCATCTCCAC (2031 to 2009)Sequencing of mutS
    mutSF11TTCCTGATGGACCTGGAAGCG (1331 to 1350)Sequencing of mutS
    mutLFCGATGATCGCCCAGCGCT (−124 to −107)Amplification and sequencing of mutL
    mutLRTCCGCCGGGTCGCGGATA (2175 to 2158)Amplification and sequencing of mutL
    mutLF2TAGCGCGCCTGACCATGA (330 to 347)Sequencing of mutL
    mutLF3GCGCATGGTGCGCGACAA (797 to 814)Sequencing of mutL
    mutLF4GCCTCCGGCGGCTCCTCCG (1178 to 1197)Sequencing of mutL
    mutLR2GCAGGTCGGCGATGACAT (1680 to 1663)Sequencing of mutL
  • a The numbers in parentheses are positions based on the mutS or mutL start codons.