TABLE 1.

Primers used to quantify putative Pho regulon transcripts of OS-B′a

GeneLocus tagSize Forward primerReverse primer
ntaa
phoACYB_11981,349449TGGTGCAAACGGGATCCATCATTGAATCTCCTCATAGTCGCTGCGCTT
phoDCYB_06841,727575GCCGCGGCGATATCGATTTCATTTCAACAAAGGAAGTCCGGCCAAACA
phoXCYB_19882,048682ACGATGCCCGCTTTGAGTACATCTCTTGGCCACATACAAGGTGCCATT
pstS-1CYB_10771,076358CACAGGTGACTTTCCCGAATATTCCACGTAGCCAATCGAG
pstS-2CYB_19151,061353ATGCGAACCCTGCTTTCTGCTTTCGAGATTTGCACGGTTTGGGCTTGA
phnC-1CYB_0159791263AAACAAGGTTGCCCTAAGGGAGGTTGGCCTTCATGGAGAGGAAGAGAA
phnD-1CYB_0160896298GCTCCCATTGAAGCGTTCGTGAAATTGCCCTTGGCGTCTTCTAGAGTT
phnC-2CYB_1467809269TGGCTCAATGGAATCGACCTCACTTAGCCCAACTGACCCGAAAGAACA
phnICYB_0164696231TGCTGGATTTGGAAATGGATCGCCAGTGGCTCATCCAGTTGCTGAGAA
phnJCYB_0165866288GTAGCATATGAAACCCAAGCATAGAACTCGAGAGGACCGCTCGTTT
  • a Included in the table are locus tags, the sizes of the gene in nucleotides (nt) and amino acids (aa), and both the forward and reverse primer sequences that were used.