TABLE 1.

Primers used in expression analysis

TargetDirection of primerPrimer sequence (5′-3′)
PBP1ForwardACCAATAACAAAAGATACTGCTGAA
ReverseCGTCACCCATAAAACTTACAAAATA
PBP2ForwardTAACAGAAACCAAGCAACAGAT
ReverseTTTGTCGTAAAGCATCATAAATAGA
PBP2aForwardCAACTAATGAAACAGAAAGTCGTAA
ReverseTAATGTATGTGCGATTGTATTGCTA
PBP3ForwardACAAAATCCTAAAAATGGAGACA
ReverseACCTTGGAAATGTAATGGTTCAT
PBP4ForwardACGATGTTTTACCAAGTGATTTTAG
ReverseACCAATGATAGTGAATAATGGATGT