TABLE 2.

Oligonucleotides

OligonucleotideaSequence (5′-3′)Position (start, end)b
RlxNco (−)AGC CAT GGCAGTTACAAAGATACATCCc−21857, −21835
RlxXho (+)TACTCGAGTAGCTCTTGCGTCCATTCCTTTCCC20532, 20556
RlxNXho (+)TACTCGAGCGCTCTGGTGATAACGCGGCC21116, 21137
RlxpBADXho (+)TACTCGAGTTCATAGCTCTTGCGTCCATTCCTTTCCC20529, 20556
C1 (+)AAGGCAGGGACGGGGCAGGCCGTTc22212, 22233
C2 (−)GCCGCGTCCGTTTTGCTTGTTGG−22209, −22187
FmutNic (+)TAAGCATAGGGAGTGTAGCC22263, 22245
RmutNic (−)CTACGTTACTGTTTCTCCAC−22265, −22284
MutAF (+)CACTCC CGGAAAAACGGCCTG22245, 22225
MutA1R (−)GCTACAGTACCTATGCTTGCTACGTTACTG−22246, −22275
MutA2R (−)CATACACTCCCTATGCTTGCTACGTTACTG−22248, −22275
MutBF (+)ATCGCGAAACCCCTGAATGGAAAGG22158, 22176
MutBR (−)TTCCCCAACAAGCAAAACGGAC−22204, −22183
MobCNdeI (−)GACATATGGCAAACAGAAAGC G−22147, −22131
MobCFHindIII (−)ATAAGCTTGGAAAGGACGGTGAAGCA−22165, −22147
MobCREcoRI (+)ATGAATTCTCGATGTAGTCAA GGG C21793, 21812
30R (−)ATAAGCTTACTTTTAGCGGGAGCTGC−22389, −22370
29F (+)ATGAATTCACCGTCCTTTCCATTCAG22150, 22170
O30DF (−)CTAAGCTTGAAACAGTAACGTAGCAAGC−22279, −22260
27FEcoRI (+)ATGAATTCATGC CGGAAAAGCCTTGAA20129, 20148
28RHindIII (−)ATAAGCTTATGAGTATTCCACGAATGA−20533, −20514
184OriF/EcoRI (+)CTGAATTCAGCAAGCATAGGGAGTGTAGCCACTCCCTGCAGAAGCTTTGACACAGTGCCG22266, 22239
184R/EcoRI (−)TAGAATTCCGGATGAGCATTCATCAGG
HTH-EcoRI (−)TGAATTCTGGCATCCTCTGTTTTACT−22404, −22385
RlxXbaI (+)AATCTAGATACTCATAGCTCTTGCGTCC20525, 20545
YXbaI (+)ATCTAGACTATCTCTGTTCCAGCGGGAAG19742, 19763
Ori34F (+)dTAACGTAGCAAGCATAGGGAGTGTAGCCACTCCC22272, 22239
Ori34R (−)dGGGAGTGGCTACACTCCCTATGCTTGCTACGTTA−22239, −22272
28RpACY (−)ACTCCACCGCTGATGACATCAG
28FpACY (+)CTTTATTCACATTCTTGCCCG
27f (+)eGCTCTAAGTGCGTAGGTTTC20166, 20185
28f2 (+)eAAACTTTCCCGGCTTGATCT21231, 21250
28f1 (+)eCCGCAGGAAATCATCAAAAT21273, 21292
28r1 (−)eGTGCAAGGAAAACGGATTGT−21435, −21416
29f2 (+)eCAGGGACGCGCAGCACGATT22108, 22127
29r2 (−)eGAGATACAGAAGATCGGCGT−21967, −21948
30f (+)eCGATGATCGGCAGGTATTCT22470, 22489
30r (−)eATTGACTGGCGCTATCTTGC−22668, −22649
Race 1(+)eGATGATCGGCAGGTATTCTT22471, 22490
Race 2(+)eATAAGCTGTATGACAACCGG22595, 22614
  • a +, sense primer; −, antisense primer.

  • b Nucleotide numbering according to GenBank accession number AF192329.1.

  • c Restriction sites used in cloning are underlined. 5′-end phosphorylated nucleotides are in bold.

  • d Oligonucleotides used in nicking assay.

  • e Oligonucleotides used in RT-PCR and 5′ RACE assays.