TABLE 2.

Genes of interest that derive from genome-wide analyses of S. mutans a

GenBank locus tagGene nameDescriptionSRE sequence (5′ to 3′)Space (bp)bClassFold change
SMU.91* ropA Trigger factorGAAAGAAACTAACTTTAATTGC105II2
SMU.113 pfk Fructose kinaseI4
SMU.114Fructose PTSI6
SMU.115Fructose PTSI6
SMU.166UnknownCAAAAATATTTTAGATATTTTG68I2
SMU.182* sloA Iron/Mn transportAAAATTAACTTGACTTAATTTT35I11
SMU.217c*UnknownAATAGAAATTAAAGATTTTTTG34I3
SMU.308 srlD Sorbitol dehydrogenaseI2
SMU.309 srlR Sorbitol operon regulatorI2
SMU.310 srlM Sorbitol operon activatorI2
SMU.311 srlA Sorbitol PTSI2
SMU.312 srlE Sorbitol PTSAAAAGTATCGTTGCTTATTTCA9I2
SMU.313 srlB Sorbitol PTS EIII3
SMU.493 pfl2 Pyruvate formate lyaseI2
SMU.494 mipB Fructose aldolaseI3
SMU.495 gldA Glycerol dehydrogenaseI3
SMU.610* spaP Surface antigenGACAAAATCCTGACTTTTTTTG197II6
SMU.629* sod Superoxide dismutaseCAAAGCAAGAATGTATATTTAG117II2
SMU.670* citB Aconitate hydrataseAGAAAAAAGGAGACTGGTTATG0I3
SMU.671* citZ Citrate synthaseI3
SMU.672* idh Isocitrate dehydrog.I3
SMU.673UnknownATCAGAAAACTACCTTTTTTTGII2
SMU.770c* hitA Iron/Mn transportAAAAGAAAAATACTTGAATTTA197I3
SMU.872 fruA Fructose PTSAAACGAAAATTATCTTACTTTAI2
SMU.877 agaL α-GalactosidaseI2
SMU.878 msmE Multiple sugar transportI2
SMU.879 msmF Multiple sugar transportI2
SMU.880 msmG Multiple sugar transportI2
SMU.881 gtfA Sucrose phosphorylaseI2
SMU.882 msmK Multiple sugar transportI2
SMU.883 dexB Dextran glucosidaseI2
SMU.924* tpx Thiol peroxidaseAAAATAAACATATTTTTATTGT154II2
SMU.961AAAATTATGTAAAAATATTTTG150II2
SMU.1012c cpsY Transcriptional regulationAAAATAATAATGGATTAATTGG82I2
SMU.1148 lctF ABC transportTGAAAAATCCTTGCTTAATTGC92II2
SMU.1165c acrR Transcriptional regulatorAAAAGAATGGTTCCTTGTTTTG133II2
SMU.1390UnknownTGAAGAATAATACTTTATTTGG284II2
SMU.1396c* gbpC Glucan bindingGAAAAAATGTCTTTTTATTGTT49I2
SMU.1421* pdhC Acid dehydrogenaseI6
SMU.1422* pdhB Pyruvate dehydrogenaseI8
SMU.1423* pdhA Pyruvate dehydrogenaseI7
SMU.1424*Pyruvate dehydrogenaseI6
SMU.1517* vicR Response regulatorII2
SMU.1535* phsG Glycogen phosphorylationGAAAGACAACTTTGAGTTTTCCCoding sequenceI2
SMU.1536* glgA Glycogen synthaseCAAATTCAGGAGTCATAATTTCCoding sequenceI3
SMU.1537* glgD Glycogen biosynthesisCTAAATCAAAAGTGATATTGGCCoding sequenceI3
SMU.1538* glgC Glucose 1P transferaseI2
SMU.1539* glgB Glycogen branchingI2
SMU.1566c malR Transcriptional repressorTAAAAAAACTTGACATTTTTCG163II2
SMU.1596 celD Cellobiose PTSc I4
SMU.1597cHypothetical proteinI4
SMU.1598 celC Cellobiose PTSI5
SMU.1599 celR Transcriptional regulatorI5
SMU.1600 celB cellobiose PTSI3
SMU.1601 celA 6-P glucosidaseI2
SMU.1746c fabM Acid toleranceAAAAATAAAAATAGTTTTTTTA132II2
SMU.1788c* bta Bacteriocin transportAAAAGAAACCTTGCAAATTTTG167II2
SMU.1917c* comE Genetic competenceAGAAGAAACTTTTCTTTTTTTG179II2
SMU.1924c* gcrR Response regulatorAAAAAACTGATGGGTTATTTTG201II2
SMU.1841 scrA Sucrose PTSI2
SMU.1843 scrB Sucrose 6P hydrolaseI2
SMU.1844 scrR Sucrose operon repressorI2
  • a Shown is a select list of S. mutans genes that derive from the genome-wide analyses we describe in Materials and Methods. If a “recognizable” SRE in or near a promoter region could be drawn from our in silico analysis, its sequence and distance from the ATG initiation codon (space) is noted. Results for the microarray platform are presented as fold changes in expression for class I (SloR downregulated) and class II (SloR upregulated) genes. The asterisk denotes functional validation of expression in qRT-PCR experiments and/or confirmation of direct SloR binding in EMSA. Gene clusters that are organized in an operon-like arrangement on the UA159 chromosome have consecutive numbers in their GenBank locus tags.

  • b Distance/spacing between the 3′ end of the SloR binding motif and the translation initiation codon.

  • c PTS, phosphotransferase system.