TABLE 2.

List of oligonucleotides used in this study

Oligonucleotide function and target gene(s) or regionForward primer (5′-3′)Reverse primer (5′-3′)Probe
Construction of mutant strains
    relE1 upstreamGGGAAGCTTTCTGCCCGGATCGAACGCGGGGCGGCCGCCGCGCGGTGTAACGGTTGCG
    relE1 downstreamGGGGCGGCCGCGCCGTACCCCGGGTACCGGGGTTAATTAAGCTGGCTCGCCGAACACC
    relE2 upstreamGGAAGCTTGGCGGGTCGGCTCGTAGCGGGAGGCCTCGCTCAGTGGGGGCGTCGC
    relE2 downstreamGGAGGCCTCAACTCACCGACGGGCGCTCGGTTAATTAACGCGGCGGACCGATCGACC
    relE3 upstreamGGGAAGCTTAGAACCCCGGCCGGTATCAGGGGGATATCTCTCACTCCTCGCCGCCGGC
    relE3 downstreamGGGGATATCGATTTGGGGGCTGGTGGTATTCGGGTTAATTAACGTGGATTTCACGCTCGCCG
    mazF1 upstreamGGAAGCTTCCGGCGAGGACGCCATCGGGGAGGCCTCGACTCCGTCGCCGACGGTC
    mazF1 downstreamGGGAGGCCTCTCTCGCAGGTTCCGCGTCGGGGTTAATTAACGATCCGTTCTGGGACCGAC
    mazF5 upstreamGGGAAGCTTCACGGCGATGGCGGGGGAGGCCTCCCGATATCACGTCAGCAAAC
    mazF5 downstreamGGGAGGCCTGAGTCTCCAGCCGCCCGGGTTAATTAAATCTCCTTAATGTGTTCTCGG
    mazF6 upstreamGGGAAGCTTTGGTGTGCGACGGGTCGTGGGGGAGGCCTTAGGTCTACAGCACTGCACC
    mazF6 downstreamGGGAGGCCTCGTACGACCTCGCGGGGGGTTAATTAAGCTATGAGCCGCTGTTCAC
Construction of overexpression strains
    relE1 GGGCATATGAGCGACGACCATCCCTACGGGGCGGCCGCTTAACGTGGCCGGCACGGGa
    relB1 and relE1 GGGCATATGGCTGTTGTCCCACTGGGCGGGGGCGGCCGCTTAACGTGGCCGGCACGGG
    relE2 GGGCATATGCCTTACACCGTGCGGTTCGGGGCGGCCGCCTATCGGCGGTAGATGTCCGCGa
    relB2 and relE2 GGGCATATGCGGATACTGCCGATTTCGGGGGCGGCCGCCTATCGGCGGTAGATGTCCGCG
    relE3 GGGCATATGGTGAGAAGCGTCAACTTCGGGGGCGGCCGCTCAGTAGTGGTATCGGGCCa
    relB3 and relE3 GGGCATATGAGCATCAGTGCGAGCGAGGGGGCGGCCGCTCAGTAGTGGTATCGGGCC
    mazF1 GGGCATATGGTGATGCGCCGCGGTGAGGGGGCGGCCGCCTACGACCATAAGTCGAGATGC
    mazF2 GGGCATATGCTGCGCGGTGAGATCTGGGGGCGGCCGCTCAGCTCGGCAGGGGAGACG
    mazF3 GGGCATATGGTGATTAGTCGTGCCGGGGGCGGCCGCTCAAAGGTCCAGTACGCGAC
    mazF4 GGGCATATGATGCGGCGCGGTGAATTGTGGGGGCGGCCGCTCAACACCCCGTGCTCGCCC
    mazF5 GGGCATATGACCGCACTTCCGGCGCGGGGGCGGCCGCTCATCGAGAGCAATCGACGG
    mazF6 GGGCATATGCGACCTATCCACATCGCGGGGCGGCCGCCTATGCCACCACCCAATCG
    mazF7 GGGCATATGAACGCGCCGTTGCGTGGGGGCGGCCGCTCATGGCCACGGTAGCCCCA
RT-PCR analysis
    relB1 CGCCGAAGTTGAGCTGACAGATGACCGTGCCGGGTTAACGAGCGCATCACG
    relE1 AATGACCTTGAAGGCCTCCAGATGGCGTAGACGACGCGTCAGCCCGCCGCGGTGATT
    relB2 TGCGGATACTGCCGATTTCCGCGTCGACGAACTCATTGACGATCAAGGGCAAGC
    relE2 CACGTTCAGCGCGCGAGGATCACTACCGTTGTGTGCTCCGCCTGCTGTACCGGATTGACGA
    relB3 CGAGGCAGCGCCTGTTCGGCTGGTGATCGGTATTGCCACTCATCGAACAGG
    relE3 TGCCTGGGAGGACTTCTTGTATCCGACGGGCCGTTTCTGGCTGGCCGCTGATCGC
    sigA GACGAGGAGATCGCTGAACCTCGTCTTCATCCCAGACGAAACCGAAAAGGACAAGGCCTCCGG
  • a This primer was also used for synthesis of cDNA from mycobacterial RNA, done using Superscript reverse transcriptase.