TABLE 1.

Bacterial strains and oligonucleotide primers used in this study

Strain, assay, or primer nameGenotype or phenotype description or nucleotide sequence (5′ to 3′)Annealing temp (°C)Amplicon length (bp)
Strain
    UA159a Wild type (serotype c)
    GMS584b SloR insertion-deletion mutant (UA159-derived); Emr
Assay and primer name
    qRT-PCR
        bta.RT.kpo.FGCTCCTAAGTTGAGTCAGGTTGCTG53.8191
        bta.RT.kpo.RGCCTCTTGTGAAAGCGATGAATC
        citZ.FAGTGCCATCAAGGATAATAAACTCTCG50.7109
        citZ.RAATGAAGATTCCAAAGGAGGTAAATGAC
        hk11.RT.FGCTGGCTAATAATGTCATCAAGC50.888
        hk11.RT.RCTCAACAGTTACTTCAATCTCCTCC
        pdh.RT.kpo.FGTGGCTTCCTTTGGACTGAGTG52.8117
        pdh.RT.kpo.RTCCTTGCGTCTCTGTTGATGC
        sloR.RT.FCATCTCTTTATCGCAAGCATCG50.7127
        sloR.RT.RCGTTCAACAAACACATCAGAAACAG
        Smu.217c.RT.kpo.FACATTATGGAAGAGGTTGTTC45.3105
        Smu.217c.RT.kpo.RAGTTATCGCTTTGTTTTCTATC
        tpx.RT.kpo.FTGGAAATACGGTGACACTTG49.6144
        tpx.RT.kpo.RATAGATGGCACAACGCTAATC
    EMSA
        pre.bta.FCGCTTCTGTAAAATGTGACA48.3317
        pre.bta.R1TGACACTTGAAGGGGAAG
        pre.bta.R2GAACATAGGTCATTAGTCG45.2155
        pre.sloABC.ForATCGGTGAATCGCACTGTCG51.1310
        pre.sloABC.RevTAAGGTTGACTTGCCCGCAC
        recA.Gel.LN.FCGGTTATCCAAAAGGGCGTATC55.3212
        recA.Gel.LN.RCCTGTTCTCCTGAATCTGGTTGTG
        pre.smu.217c.FCAATCCATAATTGAATATC44.7320
        pre.smu.217c.RGGTAAGCTAGTCTATAACG
  • a ATCC 700610.

  • b See reference 35.