TABLE 1.

Target genes and oligonucleotides used for RT-PCR

Protein function (gene ID)Primer sequenceAmplicon size (bp)Annealing temp (°C)
ForwardReverse
Malolactic enzyme (LSEI_0740)AGCAGAACGGAATCAGTATGGCGGCTTGGTCTTTAACTGAGC10358
Two-component RR (LSEI_0460)CTGATGAGGATAAAGTTCGTGGGGCTTTCCCGTCTAAAGTGG11455
Sensor kinase DpiB (LSEI_2868)CCATTGACGACATTGATTGCTCACCATAATAGGTGCGGC10262
Transcription repressor HrcA (LSEI_1567)CGTCTTAAAAGAGATCATCCGGGCGAGAACTGACGTGACC9755
XRE family transcriptional regulator (LSEI_2759)GTGGGCATGCAGTTTATTGGGGAATCAGCAATGTAACGGC14061
Arsenate reductase (glutaredoxin) (LSEI_2761)ACGTTCAGCACCTACACTGGCTTCAATCTTATCGCGGACC14155
Peptide methionine sulfoxide reductase MsrA (LSEI_1393)CCACCTATGAACAGGTTTCGGGATAGCTAATGGTGTCGGC8557
Histidinol dehydrogenase (LSEI_1433)GGGTCTATGACTTCGTTAAGCGAGGGACACGTTTGATGATGG11561
Imidazole glycerol phosphate synthase, cyclase subunit (LSEI_1429)GGATATGCACGCTTTGTTGCAGCCAACGTGTATCAATCGC11762
30S ribosomal protein S2 (LSEI_1586)GGTATCGAAGACATGCCTCGCGGTGTTAGTATCAACCATCGC12758